Determination of affinity method : Fluorescence Microscopy

Total records found: 13

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1108	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt1	AGGGTTGGTCGTCCAGCATTCCGTTCGATTGTAGTTCTGACTCTTGTGAAGTTAATGAGCTCCTTTTGCTGACTGTTGTT	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1109	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt2	TTCTGATGAGAGTTGCGACCTCCCGGATGAGTGCCCTGGCTCCGGGTTTGTCTATTTTTGGGGGTGTTGACAGATATCCT	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	Vapt2 could detect the pathogen in a wide concentration range: 8–2.0 × 10^8 cfu/ml.The Limit of Detection (LOD) was 8 cfu/ml.	13	Fluorescence Microscopy	26.8 ± 5.3 nM	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1110	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt3	ATCGGATATGAGGCCGGGTATTAAGTGGGGTTCCATATGCAAGGCAGATCTCCCAGTGTTTTTTCAGGATTGCGTTACTG	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1111	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt4	AAGAGGGCTTGGGAACTCTAGGCGTCTGTGCATTAAGCCATGTCTGCCGGGAAAGATCTGTGAAGTGTTCGCCCGCACTT	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1112	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt5	GCATGGGTATAGGGAAACCCGAGTCTAGTTTACACTGACGTTAGGAGATTACGTCTGCCGACAGAACATTCTCTCTGTGA	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1113	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt6	GGCGGGGTGTTATGAATCCACCGCGATCCGTTATGTTAGGCTGTAATCATTAAGCACTTTATGTGCACTCGTGGTATGCC	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1114	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt7	AATTACTGGAGCTTGGCCGTAGGTAGAAAGATTTGCATTATACCTGGGGGGCTCTCTGGTTGTGTTTAATTGGTTACCCC	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1115	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt8	ATGCTGCACTAGTTACCTTGCCTTTGCTTTCTTATTCTGCTCGTGCGTAAAAGTGGTTTTTCTTGCGTTGCGGGTGCTTG	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1116	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt9	TGTTCGTTCGACTTCTCCGTCGTTTTTGTATTAACGTAGACCTTGGTTGAGCATGCTTACCTCTGCTTGGATTAATGACG	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1117	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt10	TAAGGATCTTGGGTTCATGCCGCAACTGGGATGTTTGCTGCCTCCTTTATGGAGCTTAGCTGCGAGCGTTCTTGTTTGGT	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1118	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt11	GTCTAAGTGCTTCTAGGCGGATTTGGCGCGTTCCGACGATTAGACTAGGACAACGATTCAGTGGTGTCGATGGTGTGTTC	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1119	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt12	GGGGTAAGCCCGCGGCTCTCTCCTATGTATTCAGTGTACTCACGAAGATGTCCGTACTCCGTACGCTGCTATGCGTTCCC	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1120	30270541	2018	Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR	Vapt13	TCGGGGGCGCAGCTTGGGCCGTTGCTCCTGCCGGTCTCTGTGTGCGTGCGGTTCTCGCTCTTGTGGCTCCGTCCTTGGGG	80	5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3'	ssDNA	Vibrio Vulnificus	Whole cell	Identify an aptamer for the detection of V. vulnificus.	N/A	13	Fluorescence Microscopy	N/A	Detection	SELEX	N/A	N/A	N/A	N/A	N/A	N/A