Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 63
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0322 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S 1 | ATAGGAGTCACGACGACCAGAA-CGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGGCAGGG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Identify an aptamer targeted against Shigella dysenteriae and develop a sandwich-type fluorescent bioassay for quantification. | Obtained linear range between 10(2)-10(7) cfu/mL of S. dysenteriae, and the limit of detection was 50 cfu/mL | 8 | Fluorescence Binding Assay | 23.47 ± 2.48 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled and Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0323 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S12 | ATAGGAGTCACGACGACCAGAA-CCTGGCGGGTCCCGGGGTAAACGGCACAAACGATAAAGAA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0324 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S2 | ATAGGAGTCACGACGACCAGAA-AAGATGACACTTGGCAGCCGCCTCGAGTGTCCTACACGCA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0325 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S8 | ATAGGAGTCACGACGACCAGAA-GCCAGATGAGGCCGGCAGGGCCCAAGTGTTGCTCGGGCTA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0326 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S21 | ATAGGAGTCACGACGACCAGAA-TGCACGGGACAAGAGTACACGCCGATTGCCAGGCACAGTG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | 75.49 ± 3.74 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0327 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S10 | ATAGGAGTCACGACGACCAGAA-GGGGAAGCCGATCAGGCCAATCATTGAGGGTGAACTAGCT-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0328 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S19 | ATAGGAGTCACGACGACCAGAA-TTATCGGCTGGCAAAACTGCGGCTGGAGCTCACAACTAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0329 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S13 | ATAGGAGTCACGACGACCAGAA-TCAGCGAGGGCCAATTAGAAGGGTACTCATGTCTGTGGAC-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0330 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S24 | ATAGGAGTCACGACGACCAGAA-CCAGGCGGAATGTGTCTTCGTTTTGCGAGTGTTAAGGGCG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0409 | 24763818 | 2014 | Rapid fluorescent detection of Escherichia coli K88 based on DNA aptamer library as direct and specific reporter combined with immuno-magnetic separation | Apt B12 | TGGGAGCTCAGAATAAACGCTCAA-GGCACACAGGACTATACAGTGTTGCAGTGTTGCTG-TTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | DNA aptamer library for rapid detection of ETEC K88 combined with immuno-magnetic separation (IMS). | Exhibit detection limit of 1.1 × 10(3) CFU/ml in pure culture and 2.2 × 10(3) CFU/g in artificially contaminated faecal sample with aptamer library. | 13 | Fluorescence Binding Assay | 15 ± 4 nM | Diagnostic | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0410 | 24763818 | 2014 | Rapid fluorescent detection of Escherichia coli K88 based on DNA aptamer library as direct and specific reporter combined with immuno-magnetic separation | Apt H11 | TGGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | DNA aptamer library for rapid detection of ETEC K88 combined with immuno-magnetic separation (IMS). | Exhibit detection limit of 1.1 × 10(3) CFU/ml in pure culture and 2.2 × 10(3) CFU/g in artificially contaminated faecal sample with aptamer library. | 13 | Fluorescence Binding Assay | 66 ± 7 nM | Diagnostic | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0411 | 24763818 | 2014 | Rapid fluorescent detection of Escherichia coli K88 based on DNA aptamer library as direct and specific reporter combined with immuno-magnetic separation | Apt C09 | TGGGAGCTCAGAATAAACGCTCAA-TGGCCGTGTGGATAGAGGCGTGTTGTATGGGTGTG-TTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | DNA aptamer library for rapid detection of ETEC K88 combined with immuno-magnetic separation (IMS). | Exhibit detection limit of 1.1 × 10(3) CFU/ml in pure culture and 2.2 × 10(3) CFU/g in artificially contaminated faecal sample with aptamer library. | 13 | Fluorescence Binding Assay | 52 ± 8 nM | Diagnostic | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0412 | 24763818 | 2014 | Rapid fluorescent detection of Escherichia coli K88 based on DNA aptamer library as direct and specific reporter combined with immuno-magnetic separation | Apt H12 | TGGGAGCTCAGAATAAACGCTCAA-GGGGAGGCAGTGTGTTGTGCCGTGTGTATGCTTGG-TTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | DNA aptamer library for rapid detection of ETEC K88 combined with immuno-magnetic separation (IMS). | Exhibit detection limit of 1.1 × 10(3) CFU/ml in pure culture and 2.2 × 10(3) CFU/g in artificially contaminated faecal sample with aptamer library. | 13 | Fluorescence Binding Assay | 106 ± 12 nM | Diagnostic | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1238 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp1 | AGTGTGCTCTTCTCAGGTCT-GTGGCCGGGGGCACTAATGCGGGCTATAAGTCTCCTTGGG-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | 35.60 ± 6.36 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1239 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp2 | AGTGTGCTCTTCTCAGGTCT-CCTATACCTGGCATCAGAGAGCTAGGGGCCACGGTTCGCA-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | 204.38 ± 97.31 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1240 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp3 | AGTGTGCTCTTCTCAGGTCT-GGTGCTGCGATGCTTTCTGGTGGTGTATGGTTGTCTTTTG-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1241 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp4 | AGTGTGCTCTTCTCAGGTCT-CGGCGCGGTTGTGGGTACCTAGGGTTGTTGTTGCTTCTCA-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | Hp4 had excellent binding to H pylori cells and almost no binding to E coli, S aureus, or V anguillarum. | N/A | Fluorescence Binding Assay | 26.48 ± 5.72 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1242 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp5 | AGTGTGCTCTTCTCAGGTCT-GGGCTGTGGGTCGGCACGTCGTCTCTTCATGGTTGTGGTG-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1243 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp6 | AGTGTGCTCTTCTCAGGTCT-TTAGGGACCCATGGGCTAACCCGGGCACAAGATTGTCTCA-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1244 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp7 | AGTGTGCTCTTCTCAGGTCT-ACACAACCTGCCGTATTGTAACCGTCGTCCCCCCGAAGCA-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1282 | 31511614 | 2019 | Detection of Gram-negative bacterial outer membrane vesicles using DNA aptamers | GN6 | ATACCAGCTTATTCAATT-GGGTGAGGGGGGGTTCACAACGTTAAAGATAGACGGGGGA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Gram-negative Bacteria (Escherichia Coli (E. Coli) DH5α, Escherichia Coli (E. Coli) K12, and Serratia Marcescens) | Whole cell | Isolated aptamers against multiple Gram-negative bacterial species and developed an aptamer-based detection tool (ELAA) towards bacterial secretory cargo released from the outer membranes of Gram-negative bacteria. | Can detect as low as 25 ng/mL of bacterial OMVs, and dissociation constants of GN6 to OMVs derived from E. coli DH5α, E. coli K12 and S. marcescens were 0.13 ± 0.01 μg/ml, 3.70 ± 0.98 μg/ml and 0.23 ± 0.16 μg/ml, respectively. | 12 | Fluorescence Binding Assay | 29.94 ± 2.49 nM (for E. coli DH5α), 59.70 ± 10.89 nM (for E. coli K12) and 38.98 ± 6.46 nM (for S. marcescens) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 5'-Biotinylated and 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1283 | 31511614 | 2019 | Detection of Gram-negative bacterial outer membrane vesicles using DNA aptamers | GN12 | ATACCAGCTTATTCAATT-CCGAGTCCAGACTCACCGCCGCCTCCTCAAGACGTGCTGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Gram-negative Bacteria (Escherichia Coli (E. Coli) DH5α, Escherichia Coli (E. Coli) K12, and Serratia Marcescens) | Whole cell | Isolated aptamers against multiple Gram-negative bacterial species and developed an aptamer-based detection tool towards bacterial secretory cargo released from the outer membranes of Gram-negative bacteria. | GN12 was 3.6 times higher in binding to 10(8) cells of Gram-negative bacteria than to Gram-positive bacteria tested. | 12 | Fluorescence Binding Assay | 20.36 ± 2.38 nM (for E. coli DH5α), 24.80 ± 3.98 nM (for E. coli K12) and 53.83 ± 17.70 nM (for S. marcescens) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1462 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA1 | CTGCGATCAAGTTACGCACCTCGCCATGTTCCCCGCCCGGCATGTGTTATGCCCCTGTG | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | C. jejuni can be detected from 1.7 × 10(1) to 1.7 × 10(6) CFU/mL. The limit of detection (LOD) is obtained as 10 CFU/mL in PBS and 13 CFU/mL in contaminated milk samples. | 12 | Fluorescence Binding Assay | 1.37 ± 0.28 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1463 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA2 | GTTGGGTGCGGCGGGAGGGTCCCATCGGAAACCAAGCTGTGCTGAGATTTTTCCGCGAT | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 1.78 ± 0.88 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1464 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA3 | CACGCAAGTTAATCAGCGTGACATCAGGTCTAGATTCCGGCTTATAGCGCCAGGTTTCC | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 2.01 ± 0.90 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1465 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA4 | GGTGGGCTCTGTTCGGGAGGGGTATTGTTAGGACCGAGAGGCTGCATTCCGCCAGCTGC | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 2.26 ± 0.91 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1466 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA5 | GCTCTGTCTTTTCAGCTTTATCCGGGTGTGGTGGGGGGGGGATTTGCTTGGTCGGTTCT | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 3.53 ± 1.38 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1720 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B46 | GGCGGCGATGAGGATGAC-GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | LOD value as low as 27 ± 11 cells. | 15 | Fluorescence Binding Assay | 616 ± 13 cells/ml | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1721 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B48 | GGCGGCGATGAGGATGAC-ACTATTTACGTTGGAACTTAAGTCCCACATGCACTGCC-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1722 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B70 | GGCGGCGATGAGGATGAC-CTATAGTGCTCAAGTGCGATGCCAAGCTGGCACGATAG-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | B70 showed about 35% higher affinity for Brucella cells than the B46 aptamer, and the SPR sensor showed an LOD of 27 ± 11 cells. | 15 | Fluorescence Binding Assay | 632 ± 132 cells/ml | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1723 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B72 | GGCGGCGATGAGGATGAC-TCCGTGACAAGTGCGATGCCATTCCGCGTGACAGTGAT-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1832 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-19 | TCCCTACGGCGCTAAC-GACATGATGGTGCCAAACAACATTCGGAAAGCCTGACCGT-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | Limit of Detection (LOD): 4.6 CFU/mL and linear trend ranging from 10 to 10(8) CFU/mL. | 10 | Fluorescence Binding Assay | 14.19 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1833 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-3 | TCCCTACGGCGCTAAC-TGGCAAATAATGCAATTGAAGAAAGCCCCCCCCTGCCCGA-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 15.61 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1834 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-29 | TCCCTACGGCGCTAAC-TGTGAAACAAGGCAAGGGAACTGACGTCATAAGGATAGCA-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 17.38 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1835 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-37 | TCCCTACGGCGCTAAC-AAGATGAAAGACGACCGGACAGTACATATAGCGCTCTCGC-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 17.96 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1836 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-31 | TCCCTACGGCGCTAAC-ACCTGCAGTAGGGAATGCGAATGATGAGACGCCTGATTGG-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 68.83 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1837 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-24 | TCCCTACGGCGCTAAC-ACAGACAGAATGAGTGAACATAGGCCAATAACGCACGTCC-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 75.24 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1856 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab1 (A00) | TGGTGCGTGCTATTCAGAGT-GAGGGACGCATGATTGGGTGACTCCGGGAGATCATGCAAG-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 14.12 ± 2.31 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1857 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab2 | TGGTGCGTGCTATTCAGAGT-GGGGTGGACCGGGGGGATCGAATAACGCATCGCGCCTAGT-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 26.26 ± 9.87 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1858 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab3 | TGGTGCGTGCTATTCAGAGT-CCTCTAGGCGGTAAGGATCGGACCTTGGTCTGATGGTGAG-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 66.51 ± 24.28 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1859 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab4 | TGGTGCGTGCTATTCAGAGT-GACGGATACGGATTCAGGGCGGAGTGCCAAGATACGGATG-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 97.98 ± 37.42 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1860 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab5 | TGGTGCGTGCTATTCAGAGT-GTTGAGGATTAGGATCGCTTTAAACGATTAGGATCCGAAT-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 142.2 ± 39.3 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1861 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | A01 | GCGCGGGCTATTCAGAGTGAGGGCCGCGTGAGCGGGCGACTCCGGGAGATCGCGCGCG | 58 | N/A | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 27.91 ± 13.34 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1862 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | A02 | GAGCGGGCGACTCCGGGAGATCGCGCGCGG | 30 | N/A | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | Exhibited a wide detection range of up to 1 × 10(7) CFU/mL and the lowest limit of detection (LOD) of 1 CFU/mL, for each bacterium. | 12 | Fluorescence Binding Assay | 6.86 ± 5.77 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1863 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | A03 | CGACTCCGGGAGATCG | 16 | N/A | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 19.33 ± 9.76 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1864 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C00 | GTCCTGAGACTCATGTCTGCTGTCAATCGCAAGGTCCATGTCCTGAGACTCATGTCTGCTGTCAATCGCAAGGTCCA | 77 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 48.12 ± 6.15 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1865 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C01 | CGCGTGTCTGCTGTCAATCGCAAGGTCCATGTCCCGCG | 38 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | Exhibited a wide detection range of up to 1 × 10(7) CFU/mL and the lowest limit of detection (LOD) of 1 CFU/mL, for each bacterium. | 12 | Fluorescence Binding Assay | 27.69 ± 5.66 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1866 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C02 | CGCGAGTCTGCTGTCAATCGCAAGGCGCG | 29 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 61.58 ± 19.805 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1867 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C03 | CGCTGTCAATCGCG | 14 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 240.2 ± 106.85 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1868 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C04 | GCGTCCATGTCGC | 13 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 259.8 ± 55.1 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1915 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg1 | TGACTGACGACGACTC-AGTGGAGTATCGCCTTGCCGACCCGGGTGTCTACGATCAGTGAGTGGTAGT-GACTGCTCGAGCTG | 81 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1916 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg2 | TGACTGACGACGACTC-TGGAGCTCGGGTATTCTCGTCAGACCCTCCTGAGTTGATTTTAGCAACCG-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1917 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg3 | TGACTGACGACGACTC-CGGCGAGTAACGACTATGTCGCACGGGTGTCTTACGAGACGGTTGGGGTC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1918 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg4 | TGACTGACGACGACTC-CTTGTCCATGGCTTGTCCACTCGGGTGTCTGGACAATGAAACCGAACTGC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1919 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg8 | TGACTGACGACGACTC-AGAACGCTTTATGCGCACGGGGGACTTCGGAGTCGTCGAGTACGGGTACC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | 183.79 ± 3.27 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1920 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg8A | TGACTGACGACGACTCAGAACGCTTTATGCGCACGGGGGACTTCGGAGTCGTCGAGT | 57 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | Achieving a limit of detection of 10 CFU/mL. | 15 | Fluorescence Binding Assay | 133.15 ± 48.56 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1922 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss1 | TGACTGACGACGACTC-CCCGCAGGGGATCCGGATGCCGCGTTGGAGGAGATATGTATTATTCCATC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | Demonstrated a linear response across a range of 10–10(8) CFU/mL for P. micra with a limit of detection of 11 CFU/mL. | 17 | Fluorescence Binding Assay | 33.84 ± 0.92 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1923 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss2 | TGACTGACGACGACTC-GGAGAACTACCGCACCAACAATTCACCGTCTGGACGTTCTGCCCTCTCCC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | N/A | 17 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1924 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss8 | TGACTGACGACGACTC-GGGAGGTCAGACTATCTTGTTCCTCCTGGAGGTCGGGAAGAGAGTTGACG-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | N/A | 17 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1925 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss9 | TGACTGACGACGACTC-GGGGGCTGTCAAAAATTACTCTTGGGCCCAGCAATGGTAATTTTCTGACC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | N/A | 17 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2109 | https://doi.org/10.1007/s00604-017-2453-3 | 2017 | Orientation selection of broad-spectrum aptamers against lipopolysaccharides based on capture-SELEX by using magnetic nanoparticles | EA10 | N/A | N/A | 5'-ATAGGAGTCACGACGACCAG-40N-TATGTGCGTCTACCTCTTGA-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50671) | Lipopolysaccharide (LPS) lipid A domain | Identify aptamers that bind to the LPS target. | N/A | 15 | Fluorescence Binding Assay | 28 ± 4 nM | Detection | Orientation selection based on Capture-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2110 | https://doi.org/10.1007/s00604-017-2453-3 | 2017 | Orientation selection of broad-spectrum aptamers against lipopolysaccharides based on capture-SELEX by using magnetic nanoparticles | EA7 | N/A | N/A | 5'-ATAGGAGTCACGACGACCAG-40N-TATGTGCGTCTACCTCTTGA-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50671) | Lipopolysaccharide (LPS) lipid A domain | Identify aptamers that bind to the LPS target. | EA7 binds to the lipid A region of LPS and exhibits a detection limit of 3 ng/mL and a linear range of 5–250 ng/mL. | 15 | Fluorescence Binding Assay | 102 ± 17 nM | Detection | Orientation selection based on Capture-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2111 | https://doi.org/10.1007/s00604-017-2453-3 | 2017 | Orientation selection of broad-spectrum aptamers against lipopolysaccharides based on capture-SELEX by using magnetic nanoparticles | EA5 | N/A | N/A | 5'-ATAGGAGTCACGACGACCAG-40N-TATGTGCGTCTACCTCTTGA-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50671) | Lipopolysaccharide (LPS) lipid A domain | Identify aptamers that bind to the LPS target. | N/A | 15 | Fluorescence Binding Assay | 149 ± 30 nM | Detection | Orientation selection based on Capture-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |