Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 406
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0042 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | hemag1P | AGCAGCACAGAGGTCAGATG-TAGCCCTTCAACATAGTAATATCTCTGCATTCTGTGTG-CCTATGCGTGCTACCGTGAA | 78 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | The number of aptamer molecules binding to each cell (on average, ∼164 ± 47 aptamer molecules per cell). | 8 | Flow Cytometry | 13 ± 3 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0043 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | hemag1 | TAGCCCTTCAACATAGTAATATCTCTGCATTCTGTGATG | 39 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0044 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | mag1 | TGAGCCCCACTAAAGTTGCAATCATGTCGTCAGCTTTGGG | 40 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0045 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | hemag3 | CGTCGCGGCATATTTCCAGTGGAACGGTTACGATATGTTG | 40 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0046 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | mag1P | AGCAGCACAGAGGTCAGATG-TGAGCCCCAGTAAAGTTGCAATCATGTCGTCAGCTTTGGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0047 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | hemag3P | AGCAGCACAGAGGTCAGATG-TCGTCGCGGCATATTTCCAGTGGAACGGTTACGATATGTTG-CCTATGCGTGCTACCGTGAA | 81 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0049 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA20 | GCAATGGTACGGTACTTCC-GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Identify aptamers that bind to S. aureus strains, including 8325-4, 196, and 04018, and develop a probe to distinguish them from S. epidermidis, Streptococcus, and E. coli. | EC50 = 70.86 ± 39.22nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0050 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA23 | GCAATGGTACGGTACTTCC-GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50 = 61.50 ± 22.43nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0051 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA31 | GCAATGGTACGGTACTTCC-TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50=82.86 ± 33.20nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0052 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA34 | GCAATGGTACGGTACTTCC-CACAGTCACTCAGACGGCCGCTATTGTTGCCAGATTGCCTTTGGC-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50 =72.42 ± 35.23nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0053 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA43 | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50 = 210.70 ± 135.91nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0093 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A24P | AGCAGCACAGAGGTCAGATG-GGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGG-CCTATGCGTGCTACCGTGAA | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 20A24P forms a branched structure with high affinity for the target cell mixture (gated fluorescence intensity above library of 64%). | 20 | Flow Cytometry | 9.1 ± 0.8 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0094 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 15A3P | TTCACGGTAGCACGCATAGG-GACAGCAAGCCCAAGCTGGGTGTGCAAGGTGAGGAGTGGG-CATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | Show a gated fluorescence above the background of 48%. | 20 | Flow Cytometry | 9.6 ± 0.3 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0095 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A1 | CAGAACGCACCCGCACACCTCCATCACTCGCATGCACCCC | 40 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 72% gated fluorescence intensity above the library. | 20 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0096 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A1P | TTCACGGTAGCACGCATAGG-CAGAACGCACCCGCACACCTCCATCACTCGCATGCACCCC-CATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 72% gated fluorescence intensity above the library. | 20 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0097 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A8 | CCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCC | 40 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 20A8 binding to the target GAS cells yielded 72% gated fluorescence above background. | 20 | Flow Cytometry | 4 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0098 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A8P | AGCAGCACAGAGGTCAGATG-CCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCC-CCTATGCGTGCTACCGTGAA | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 20A8P binding to the target GAS cells yielded 68% gated fluorescence above background. | 20 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0099 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A9 | CACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGG | 39 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 65% gated fluorescence intensity above the library. | 20 | Flow Cytometry | 9 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0100 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A9P | AGCAGCACAGAGGTCAGATG-CACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGG-CCTATGCGTGCTACCGTGAA | 79 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 66% gated fluorescence intensity above the library. | 20 | Flow Cytometry | 9.1 ± 0.6 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0101 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A12P | TTCACGGTAGCACGCATAGG-GCCCGACACTCGTCCACCCGATACCTCTCATGTGTCCC-CATCTGACCTCTGTGCTGCT | 78 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | N/A | 20 | Flow Cytometry | 25 ± 3 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0102 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A14P | AGCAGCACAGAGGTCAGATG-GGCATGGGGAAGAGAAAGCGGGATAACTTCGTTACCGGGC-CCTATGCGTGCTACCGTGAA | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | N/A | 20 | Flow Cytometry | 17 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0105 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F23 | ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | F23 showed great specificity to P. aeruginosa and no cross-reactivity with other bacterial species. | 15 | Flow Cytometry | 17.27 ± 5.00 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0106 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F12 | ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTTGCTTTTGTTCGCTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0107 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F8 | ATACCAGCTTATTCAATT-CCGTGGCGTTCTGTTTGTTCGTTGTTTTTTGGTTTTTCCTTCTTTTTTTGTTTTTGGTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0108 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F1 | ATACCAGCTTATTCAATT-GGCGCGCGTTGTGTGGTTTGGCTTTTTTCGTTTGTTTTTCTTGGGTGCTTGTCTTCGTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0109 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F20 | ATACCAGCTTATTCAATT-CCCTCGCCGTACGTTCTCCGTTTTGTCAGGTGTTGTTTTTTCCGTCCTCTTCTCGTGTGC-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0110 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F4 | ATACCAGCTTATTCAATT-CCACCGATTCCCTTCGATCGTATTCGTGTTGCTCTCGTGTTGTAATGCGTCCTGTGCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0111 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F6 | ATACCAGCTTATTCAATT-GGCACCGGCTTGTCTGTTTCTCTTGGTTCGCCGCTGGACTTTGTTAGCTCCCTCCGCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0112 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F7 | ATACCAGCTTATTCAATT-CCCCACAACCTGACCTTTCTATTCCGTTCCCCTTTTTTCAGCTTCTTTCCGGCCTCTGTT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0113 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F18 | ATACCAGCTTATTCAATT-CCACCACCGGGTTGTTTTTCCTGCAGGCCTTTATCGTTTTCCGCGCTCGATTCGGTCATG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0114 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F5 | ATACCAGCTTATTCAATT-CCACCGTGCTTTATATTACCCGTCCACCCTTCGGTCTTTCTCCCCGTGTCGCTCCGCTTT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0115 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F21 | ATACCAGCTTATTCAATT-CCACCGGGCCTCGTATTCGTACTGTTTGATTCTTTGGCTTTGTAGCGGACGTACTGGGTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0116 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F2 | ATACCAGCTTATTCAATT-CCCCCGCGCCCGTCTCTCTCAATCTCCGCATTCTTTAGTTCTCATCCTCCCTGTGTGTTT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0117 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F24 | ATACCAGCTTATTCAATT-GACACCCGGAGTAATTCCGTTTTAAGCGTCTTTCATGTGTTCCCTTTCGTTCCTCCCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0118 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F15 | ATACCAGCTTATTCAATT-CCCAAGGTCGAGTTCCTAGTCTTACCGTATTTCACTTTCCTGGTTCTTACCTCCCCCTCA-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0119 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F22 | ATACCAGCTTATTCAATT-CGGCGCGAGTCGACTGCACAGGGTCCTATTGCTTATGGTCATGGTTTCGTTTCATCCTCG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0120 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F16 | ATACCAGCTTATTCAATT-CCCGCGATATGACCATCCAGCTGCTCCTCTGTTATTGTTGGTTTTCCTGTTTTCCTTTGT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0121 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F17 | ATACCAGCTTATTCAATT-CCCCAGTGCTCAGCTTCTCCTCCGTCTCATTCTTCTGTAGGATCGTTCTGTTTTGGTACT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | 57.63 ± 11.64 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0122 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F10 | ATACCAGCTTATTCAATT-CCCACCGTCCTCGTGCTTAGTCTTTATGTTTCGTCCTTTTCTTTCTTCGTTCTGTCGCCT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0124 | 22310030 | 2012 | Development of RNA aptamers for detection of Salmonella Enteritidis | S25 | GGGUUCACUGCAGACUUGACGAAGCUU-GAGAGAUGCCCCCUGAUGTGCAUUCUUGUUGUGUUGCGGC-AAUGGAUCCACAUCTACGAAUUC | 90 | 5'-GGGUUCACUGCAGACUUGACGAAGCUU-N40-AAUGGAUCCACAUCUACGAAUUC-3' | ssRNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify an aptamer that binds to the outer membrane protein C and specifically recognizes S. enteritidis without any cross-reactivity to other Salmonella serovars. | Fluorescence intensity of S. Enteritidis enhanced as the concentration of the aptamer S25 increased from 5 to 30 μg. | 10 | Flow Cytometry | N/A | Detection | Magnetic Bead (MB)-based SELEX | 5'-Fluoro-labeled with Fluorescein-maleimide | N/A | N/A | N/A | N/A | N/A |
| ABdb_0125 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A3P | ATAGGAGTCACGACGACCAGAA-TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | Showed a high binding affinity of 76% for V. parahemolyticus and a low apparent binding affinity of 4% for other bacteria. | 9 | Flow Cytometry | 16.88 ± 1.92 | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0126 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A1 | TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG | 40 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A1 was 64%. | 9 | Flow Cytometry | 22.92 ± 4.72 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0127 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A1P | ATAGGAGTCACGACGACCAGAA-TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A1P was 67%. | 9 | Flow Cytometry | 21.45 ± 2.62 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0128 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A3 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A3 was 75%. | 9 | Flow Cytometry | 24.03 ± 5.18 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0129 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A17P | ATAGGAGTCACGACGACCAGAA-AGGCCGGCCCCTCTGAACTAGATGCAGGGGAGGCGAGCGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0130 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A18P | ATAGGAGTCACGACGACCAGAA-GCGGGCAGCTCCACCGGTAGGCTCCGAGTCATCACGGTCG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A18P was 62%. | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0131 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A21P | ATAGGAGTCACGACGACCAGAA-TTTTGACGAAGTCAGTGCGTCGAAGCGCAAGCATTACAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0157 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-1 | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTG | 46 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0158 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-2 | ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCAT | 40 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0159 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-3 | GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGC | 39 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | Successfully detect S. typhimurium down to 600 CFU/mL (equivalent to 18 live cells in 30 μL of assay volume) and distinguish it from other Salmonella species, including S. enteritidis and S. choleraesuis. | 12 | Flow Cytometry | 25 nM | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0160 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-4 | CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0161 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-5 | GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTCGCATAGGTAGTCCAGAAGCC | 61 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0162 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-6 | CTCCTCTGACTGTAACCACG-GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGCC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0163 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-7 | CTCCTCTGACTGTAACCACG-GTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGTC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0164 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-8 | CTCCTCTGACTGTAACCACG-GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0165 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-9 | CTCCTCTGACTGTAACCACG-ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCATC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0197 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-3 (80nt) | CTCCTCTGACTGTAACCACG-TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0198 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-3 (60nt) | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 7.8 ± 6.1 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0199 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-6 (79nt) | CTCCTCTGACTGTAACCACG-TAACGTACCAAAATGTTGGATTGGATGTTGTACTGGGTT-GCATAGGTAGTCCAGAAGCC | 79 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 53 ± 7 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0200 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-6_54 | TACCAAAATGTTGGATTGGATGTTGTACTGGGTTGCATAGGTAGTCCAGAAGCC | 54 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 6.3 ± 0.58 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0201 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-20_80 | CTCCTCTGACTGTAACCACG-CACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 28 ± 3.8 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0202 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-20_60 | CTCCTCTGACTGTAACCACGCACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis and 43 ± 4% (SE-20, 60nt) in S. enteritidis. | 12 | Flow Cytometry | 7.1 ± 0.62 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0203 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-22_80 | CTCCTCTGACTGTAACCACG-TATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 30 ± 4.1 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0204 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-22_60 | CTCCTCTGACTGTAACCACGTATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 5.3 ± 0.7 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0205 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-11_60 | CTCCTCTGACTGTAACCACGAACGATTCAAGAACTGTTGGTTGTCGGCTTATTTTCGCCA | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 6.9 ± 0.4 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0206 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-34_80 | CTCCTCTGACTGTAACCACG-TGCCGCTAAACGCCGGCTCATCGTTATGCTTTTCATTGCA-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 56 ± 7.1 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0207 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-1_40 | GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGC | 39 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0208 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-6_60 | GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTCGCATAGGTAGTCCAGAAGCC | 61 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0209 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-12_80 | CTCCTCTGACTGTAACCACG-GTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGTC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0210 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-12_60 | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT | 59 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium and 62 ± 12% (ST-12, 60nt) in S. typhimurium. | 12 | Flow Cytometry | 4.5 ± 0.4 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0211 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-20_80 | CTCCTCTGACTGTAACCACG-ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCATC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0212 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-20_40 | ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCAT | 40 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0213 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-33_60 | CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | 51.0 ± 4.3 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0214 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST2P | ATAGGAGTCACGACGACCAGAA-AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | The limit of detection (LOD) was 25 cfu/mL, and the percentage gated fluorescence intensity above library background was 20% when ST9P was incubated with L. monocytogenes cells and 72% when incubated with S. typhimurium. | 9 | Flow Cytometry | 6.33 ± 0.58 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0215 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST2 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | Gated fluorescence intensity above background remained at 82 ± 2.34% for ST2. | 9 | Flow Cytometry | 16.34 ± 0.45 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0216 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST3P | ATAGGAGTCACGACGACCAGAA-TTTCGGCTAAGGACGGGTGAAATACATTTAATAGGGTGGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | N/A | 9 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0217 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST7P | ATAGGAGTCACGACGACCAGAA-TAAGTACAGGACTGGAGTATTAGCGGGGTCCATGCAAGGC-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | N/A | 9 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0218 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST9 | AATCAATAGAAGACAAAGTCCGAAACAGGTGTGACGGTAA | 40 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | Gated fluorescence intensity above background remained at 72 ± 1.57% for ST9. | 9 | Flow Cytometry | 9.45 ± 0.63 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0219 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST9P | ATAGGAGTCACGACGACCAGAA-AATCAATAGAAGACAAAGTCCGAAACAGGTGTGACGGTAA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | Gated fluorescence intensity above background remained at 66 ± 1.45% for ST9P. | 9 | Flow Cytometry | 11.14 ± 0.12 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0238 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA1 | ATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA | 75 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA1 and DTMRSA3 showed the best specificity for MRSA. | 17 | Flow Cytometry | 1.6 ± 0.5 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0239 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA2 | ATCCAGAGTGACGCAGCA-CGACACGTTAGGTTGGTTAGGTTGGTTAGTTTCTTG-TGGACACGGTGGCTTA | 70 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA2 and DTMRSA4 bound to all three types of clinical bacterial strains. | 17 | Flow Cytometry | 2.0 ± 0.6 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0240 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA3 | ATCCAGAGTGACGCAGCA-GTAGATGGTTTGGTTGGTGTGGTTTCCTACTGATGTTGGG-TGGACACGGTGGCTTAGTA | 77 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA1 and DTMRSA3 showed the best specificity for MRSA. | 17 | Flow Cytometry | 1.3 ± 0.5 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0241 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA4 | ATCCAGAGTGACGCAGCA-TTATGGGGTGTGGTGGGGGGTTAATGCGTTGGTTATCCG-TGTGGACACGGTGGCTTA | 75 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA2 and DTMRSA4 bound to all three types of clinical bacterial strains. | 17 | Flow Cytometry | 9.5 ± 2 × 10(1) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0250 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-17 | AGTATACGTATTACCTGCAGC-GAGGGAAGAAGGGCCAGCACAGATCAGATCAATCGCTCCG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | Lbi-17 showed maximum binding of 78.7 ± 12.38% with an LOD of the combined AMC-qPCR method of 1.8 log10 CFU/500μl L.monocytogenes and ranged from 26% to 77%. | 6 | Flow Cytometry | 35.7 ± 8.02 μM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0251 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-16 | AGTATACGTATTACCTGCAGC-AAATACTTTAGATCTAAGAGTGTTTCGAAAAGACAACAGA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0252 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-118 | AGTATACGTATTACCTGCAGC-TTGAATTAATAGATTAGTATACTTGGGAATCGTCCTAATA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0253 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-200 | AGTATACGTATTACCTGCAGC-AGGAAGACAAATTCCGCCAAAAAGTGGATATAACCAATAA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0254 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-203 | AGTATACGTATTACCTGCAGC-ATAGAGTAGAAGCTACACTACGTAATCACAGACAGATCCA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0331 | 23494620 | 2013 | Selection of DNA aptamers for capture and detection of Salmonella Typhimurium using a whole-cell SELEX approach in conjunction with cell sorting | S8-7 | GTATACGTATTACCTGCAGC-CTGATGTGTGGGTAGGTGTCGTTGATTTCTTCTGGTGGGG-CGATATCTCGGAGATCTTGC | 80 | 5'-GTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (Strain S913) | Whole cell | Identifying aptamers selected by whole-cell SELEX and developing a qPCR-based capture-detection platform for Salmonella Typhimurium. | N/A | 10 | Flow Cytometry | 1.73±0.54 μM | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0332 | 23494620 | 2013 | Selection of DNA aptamers for capture and detection of Salmonella Typhimurium using a whole-cell SELEX approach in conjunction with cell sorting | S8-46 | GTATACGTATTACCTGCAGC-CTTGGGCGGTTGGTGTGATGGGCTTTTTTCGTTGGGCCGG-CGATATCTCGGAGATCTTGC | 80 | 5'-GTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (Strain S913) | Whole cell | Identifying aptamers selected by whole-cell SELEX and developing a qPCR-based capture-detection platform for Salmonella Typhimurium. | Achieved a Lower Limit of Detection (LOD) of 10(2)-10(3) CFU in a 290-μl sample, and the mean capture efficiency ranged from 3.6% to 12.6%. | 10 | Flow Cytometry | 0.74±0.20 μM | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0396 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G6-25 | GGATCTGGTTAGTGAAGAGGGGGGAGGGGGGGTTGGGCTGTGGGGCGGTTAGTCGT | 56 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 6 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0397 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G11-5 | ATACATCTTAAGTCTCGTGGGGGGAGGGGGGGTTGGTGGGCTTT | 44 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | β-structure of membrane associated protein | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | Colorimetric assay demonstrated detection of S. mutans cells at a concentration range of 1 × 10(5)-10(8) CFU/mL. | 11 | Flow Cytometry | 33 nM | Detection | In Silico Maturation (ISM) | 5'-Thiolated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0398 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G11-6 | ATACTATCGCATTCCTTCCGAGGGGGGAGGGGGGGGTGGGGGTCGGT | 47 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | β-structure of membrane associated protein | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | Showed the highest binding signals to S. mutans with a 16-fold increase over SMa#3-6-P1. | 11 | Flow Cytometry | 33 nM | Detection | In Silico Maturation (ISM) | 5'-Fluorescein Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0399 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#3-6-P1 | ATACCAGCTTATTCAATTGGGGGGAGGGGGGGTTGGGCTGTGGGGCGGTTAGCCGC | 56 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 3 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0400 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G11-20 | CTACGTCTAGATTCCAGTCGAGGGGGGAGGGGGGGTTTTGGATCGGT | 47 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 11 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0401 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G10-11 | CAACCTGCTTATCTAAGGGGGGGAGGGGGGGTTGTGGGTAGGT | 43 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 10 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0402 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G2-1 | CTAGCAGTTCATTCAATAGGGGGGACGGGGGGTTAGGCTAGACTATGTCTAATCA | 55 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 2 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0403 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G5-5 | ATACACGTAAGTACCATTGGGCGGGGGGGGTGTTGTTTTCTACTATGTGCAATCG | 55 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 5 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0404 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G11-8 | ACACCACTTAATTCCATGCGAGGGGGGAGGGGGGGTTCGGGGACGGC | 47 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 11 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0435 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-2 | AGTATACGTATTACCTGCAGC-TGGGGGGTGGTTGGGGGTAGTATATCGGGTCAGTGGTGCG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0436 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-103 | AGTATACGTATTACCTGCAGC-GGGAGGCGTGAAGTGTGATGGTGTGGGGGGTAGTGGCCGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0437 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-109 | AGTATACGTATTACCTGCAGC-CCGCTCAACAAGGTGCTACAAAGATCCTGTGTCCCTTGGC-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0438 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-116 | AGTATACGTATTACCTGCAGC-TACTCGTTATTTCGTAGCACTTTTCCCCACCACCTTGGTG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | LM6-116 showed strong genus-specific binding affinity when screened against five different species within the Listeria genus. | 6 | Flow Cytometry | 74.4 ±52.69 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0439 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-118 | AGTATACGTATTACCTGCAGC-CTGGTATAGACGTTATTCGTCCGCTCTTGTATCCTTGTGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0440 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-121 | AGTATACGTATTACCTGCAGC-TGTCGGTGGGGGGTGGCTTGAGTACGTGACGTGGTGTGGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0441 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-2 | AGTATACGTATTACCTGCAGC-CCATTGTTCTATCGCTAGCTCGCTCTGGCCAGCTCCTTGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0442 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-6 | AGTATACGTATTACCTGCAGC-TCTGTGTTCCGTTTTCGATTCTTACTGTGTTTTCGGGTGC-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | 106.4 ±43.91 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0443 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-13 | AGTATACGTATTACCTGCAGC-TGGGGGGGGGGGGAGGGGTCGGTGAGCGTGGGAGGAGGAG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0444 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-74 | AGTATACGTATTACCTGCAGC-CCGACCTTCTATCCTTCCAGTTTTTTGTAAACTCTTCTGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0446 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mA_Apt1 | CACAGCGGGACAGUUUAGC-AUUAGCUAUCUUCCACGAUUCGAUCAGGCAGUACGUCGU-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | A limited neutralization of Stx2-mediated cytotoxicity and death of HeLa cells was observed with aptamer mA_Apt1 (~40% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | Best Candidate | N/A | N/A |
| ABdb_0447 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mB_Apt23 | CACAGCGGGACAGUUUAGC-ACAGUUAUCCGACUGCUAUUCGAUCAGGCAGUACGUAGC-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Inhibited Stx2 binding weakly in approximately 50% of HeLa cells. A limited neutralization of Stx2-mediated cytotoxicity and death of HeLa cells was observed with aptamer mB_Apt23 (~20% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0448 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mC_Apt41 | CACAGCGGGACAGUUUAGC-CAGGCUGUUCUGACGCAUAAGGAAUGCGCUGUUGCAGAG-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | mC_Apt41 neutralized 0.007 pmole of Stx2 (≤60% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0449 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mD_Apt46 | CACAGCGGGACAGUUUAGC-UUGGUCCUGCUUUGGAUAGUCGCGAAAGGGGUGCCACUG-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Inhibited Stx2 binding weakly in approximately 50% of HeLa cells. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0450 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pA_Apt1 | CACAGCGGGACAGUUUAGC-ACAGUUAUCCGACUGCUAUUCGAUCAGGCAGUACGUAGC-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Inhibited Stx2 binding weakly in approximately 50% of HeLa cells. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0451 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pB_Apt14 | CACAGCGGGACAGUUUAGC-ACCGAGCGGUUUUACGUCUCAAGUAGUAUCCCGUUUUGC-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Did not inhibit Stx2 binding. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0452 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pC_Apt22 | CACAGCGGGACAGUUUAGC-AUUAGCUAUCUUCCACGAUUCGAUCAGGCAGUACGUCGU-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | A limited neutralization of Stx2-mediated cytotoxicity and death of HeLa cells was observed with aptamer pC_Apt22 (≤60% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0453 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pD_Apt25 | CACAGCGGGACAGUUUAGC-UUGCCAUCCUGUACUAUGCUCUAUCGGGCGGUUUAGUGAUCCUUCGUCCAACUAUC-GGUAGGUGGGUGCGUCUAAA | 95 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Did not inhibit Stx2 binding. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0559 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | E-CA 20 | CACACACGGAACCCCGACAACATACATACGGTGAGGGTGG | 40 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | Showed a 55% increase in the gated fluorescence intensities above background. | 8 | Flow Cytometry | 7 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0560 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | E-CA 20P | TTCACGGTAGCACGCATAGG-CACACACGGAACCCCGACAACATACATACGGTGAGGGTGG-CATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | Showed a 61% increase in the gated fluorescence intensities above background. | 8 | Flow Cytometry | 12 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0561 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | D-Cells 9 | GGGGAGGAGAAAAAGAGGACCAGAGTAACGATTCGTGGGG | 40 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | Showed a 55% increase in the gated fluorescence intensities above background. | 8 | Flow Cytometry | 71 ± 23 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0562 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | D-Cells 9P | TTCACGGTAGCACGCATAGG-GGGGAGGAGAAAAAGAGGACCAGAGTAACGATTCGTGGGG-CATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | D-Cells 9P showed an increase in the gated fluorescence above background by 65%. | 8 | Flow Cytometry | 44 ± 8 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0563 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | E-Cells 1P | TTCACGGTAGCACGCATAGG-GGGGAGGAGAAAAGAGGACCAGAGTAACGATTCGTGGGG-CATCTGACCTCTGTGCTGCT | 79 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | N/A | 8 | Flow Cytometry | 20 ± 3 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0564 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | E-Cells 1 | GGGGAGGAGAAAAGAGGACCAGAGTAACGATTCGTGGGG | 39 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | N/A | 8 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0565 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | D-Cells 20P | TTCACGGTAGCACGCATAGG-GGGGAGGAGAAATAGAGGACCAGAGTAACGATTCGTGGGG-CATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | N/A | 8 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0676 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A24P (Parental) | AGCAGCACAGAGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCTATGCGTGCTACCGTGAA | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | 5′-α-Gal, 3′-FAM α20A24P significantly increased phagocytosis in the presence of either transgenic mouse IgG or hIVIG. | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled, 5′-α-Gal or Biotin-TEG modified | N/A | N/A | N/A | N/A | N/A |
| ABdb_0677 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A24P.A2 | AGCACAGAGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCTATGCGTGCT | 69 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0678 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A24P.A3 | AGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCC | 52 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | 5′-α-Gal α20A24P.A3 significantly increased phagocytosis in the presence of either transgenic mouse IgG or human IVIG. | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled and 5′-α-Gal | N/A | N/A | N/A | N/A | N/A |
| ABdb_0679 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A24P.A4 | AGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCA | 53 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0680 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A24P.A5 | AGGTCAGATGGGGGGAAGACAC | 22 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0681 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A24P.A6 | AAGGCCGGGGTGAAGTGTAGAGGCCTA | 27 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0682 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A24P.A8 | TGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGC | 43 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0683 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A24P.A9 | AGAGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCTAT | 57 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0684 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 15A3P | TTCACGGTAGCACGCATAGGGACAGCAAGCCCAAGCTGGGTGTGCAAGGTGAGGAGTGGGCATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0685 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A1P | TTCACGGTAGCACGCATAGGCAGAACGCACCCGCACACCTCCATCACTCGCATGCACCCCCATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0686 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A8P | AGCAGCACAGAGGTCAGATGCCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCCCCTATGCGTGCTACCGTGAA | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0687 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A8 | CCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCC | 40 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0688 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A9P | AGCAGCACAGAGGTCAGATGCACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGGCCTATGCGTGCTACCGTGAA | 79 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0689 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A9 | CACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGG | 39 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0690 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A12P | TTCACGGTAGCACGCATAGGGCCCGACACTCGTCCACCCGATACCTCTCATGTGTCCCCATCTGACCTCTGTGCTGCT | 78 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0691 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A14P | AGCAGCACAGAGGTCAGATGGGCATGGGGAAGAGAAAGCGGGATAACTTCGTTACCGGGCCCTATGCGTGCTACCGTGAA | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0713 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp1 | TGAGCCCAAGCCCTGGTATG-TTCTTCCCTTTTATTAGTCCTGTATTCCTCTACTGTTGCC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | With sandwich Sp1 and Sp20, the aptamer assay achieved a concentration range for S. sonnei of 10(2) cfu/mL to 10(7) cfu/mL and a detection limit of 30 cfu/mL. | 12 | Flow Cytometry | 5.98 ± 0.835 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled and Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0714 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp13 | TGAGCCCAAGCCCTGGTATG-TATCCGATTTTATCTGTCCAATATTCCCTGTGTCTACCTT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 97.38 ± 36.2 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0715 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp16 | TGAGCCCAAGCCCTGGTATG-TATCTTCACTTGACCTTTACCGCAATCGTCCATGTATCTG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 682.2 ± 125 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0716 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp19 | TGAGCCCAAGCCCTGGTATG-TTCTACCCAACTGCTTTAATAGTCACTGTCATAGTTCCAC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0717 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp20 | TGAGCCCAAGCCCTGGTATG-TCGTCGATTATTGTTTCAGTTCAGTTCCCCCGCGTTCCGA-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | With sandwich Sp1 and Sp20, the aptamer assay achieved a concentration range for S. sonnei of 10(2) cfu/mL to 10(7) cfu/mL and a detection limit of 30 cfu/mL. | 12 | Flow Cytometry | 14.32 ± 2.19 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled and HEX (hexachlorofluorescein) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0718 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp22 | TGAGCCCAAGCCCTGGTATG-CCTACCTTAGTCCGTTTCGCTGTGTTTGTCCAATATTCCT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 4.98 ± 0.357 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0719 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp23 | TGAGCCCAAGCCCTGGTATG-CTTCACTTGACCCTTATCGCTTCTAACACAACCGCTTTTT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 5.735 ± 0.478 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0720 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp28 | TGAGCCCAAGCCCTGGTATG-TATTCCCCCTTATTTTAGCCATTTTGTTACATCTTCCGTC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 72.89 ± 22.16 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0721 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp29 | TGAGCCCAAGCCCTGGTATG-ATATTCGTTCTTTTCGCCTTAACTTCTCGTGTTTCCTTAC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 47.83 ± 9.7 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0780 | 28121169 | 2016 | Development of a DNA aptamer that binds specifically to group A Streptococcus serotype M3 | 12L18A | GCCTGTTGTGAGCCTCCTAAC-TCCTCGAGGGGGGGGGGATGAAAAGGAAAACGCAACAA-CATGCTTATTCTTGTCTCC | 78 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Group A Streptococcus (GAS) serotype M3 | Whole cell | Identify aptamers against S. pyogenes serotype M3. | 74% efficiency toward the S. pyogenes serotype M3. | 12 | Flow Cytometry | 7.47 ± 1.72 pM | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0781 | 28121169 | 2016 | Development of a DNA aptamer that binds specifically to group A Streptococcus serotype M3 | 12L12A | GCCTGTTGTGAGCCTCCTAAC-GAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATA-CATGCTTATTCTTGTCTCC | 78 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Group A Streptococcus (GAS) serotype M3 | Whole cell | Identify aptamers against S. pyogenes serotype M3. | N/A | 12 | Flow Cytometry | 8.25 ± 1.43 pM | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0782 | 27234880 | 2016 | Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates | Aci49 | GCCTGTTGTGAGCCTCCTAAC-TACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCTACTGT-CATGCTTATTCTTGTCTCC | 83 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | Identify aptamers against and develop a sandwich enzyme-linked aptamer sorbent assay (ELASA) for the rapid detection of A. baumannii from clinical isolates. | Display detection limit of 10(3) CFU/ml, and the sensitivity of the test toward the clinical isolates was 95.47%. | 12 | Flow Cytometry | 7.547 ± 1.353 pM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0783 | 27234880 | 2016 | Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates | Aci55 | GCCTGTTGTGAGCCTCCTAAC-GTTACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCT-CATGCTTATTCTTGTCTCC | 80 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | Identify aptamers against and develop a sandwich enzyme-linked aptamer sorbent assay (ELASA) for the rapid detection of A. baumannii from clinical isolates. | N/A | 12 | Flow Cytometry | 10.70 ± 2:561 pM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0814 | 26768582 | 2016 | DNA aptamers for the detection of Haemophilus influenzae type b by cell SELEX | Clone 63 | GCCTGTTGTGAGCCTCCTAAC-AGGAGGCGAACGGGCAGGTTCTTGGGGAGACAAGAATAAG-CATGCTTATTCTTGTCTCC | 80 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Haemophilus Influenzae type b (Hib) (ATCC 10211) | Whole cell | Identify an aptamer against Hib for the detection of H. influenzae. | Clone 63 could detect Hib in patients’ CSF samples at 60 CFU/mL. | 7 | Flow Cytometry | 28.46 pM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0815 | 26768582 | 2016 | DNA aptamers for the detection of Haemophilus influenzae type b by cell SELEX | Clone 2, 42, 45 | GCCTGTTGTGAGCCTCCTAAC-GCCAGGTGTTTTGGCGGTAGGGGTGAAACAACAGGGGG-CATGCTTATTCTTGTCTCC | 78 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Haemophilus Influenzae type b (Hib) (ATCC 10211) | Whole cell | Identify an aptamer against Hib for the detection of H. influenzae. | N/A | 7 | Flow Cytometry | 47.10 pM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0830 | 29594592 | 2017 | Selection of DNA aptamers against Mycobacterium tuberculosis Ag85A, and its application in a graphene oxide-based fluorometric assay | Apt22 | GCTGTGTGACTCCTGCAA-GCGGGAAGAGGGTAAGGGGAGGGAGGGTAACGCGGAGAAGGCAA-GCAGCTGTATCTTGTCTCC | 81 | 5'-GCTGTGTGACTCCTGCAA-N43-GCAGCTGTATCTTGTCTCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Antigen 85 (Ag85A) (FbpA) | Identify aptamers that bind to and develop a graphene oxide-based fluorometric assay to detect FbpA. | Display LOD in PBS and serum of 1.5 nM and 2.1 nM, respectively, with an analytical linear range from 5 to 200 nM of FbpA. | 12 | Flow Cytometry | 62.95 nM | Biosensor | Magnetic Bead (MB)-based Protein SELEX | ATTO647N-labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0831 | 29594592 | 2017 | Selection of DNA aptamers against Mycobacterium tuberculosis Ag85A, and its application in a graphene oxide-based fluorometric assay | Apt8 | GCTGTGTGACTCCTGCAA-TCAGGAAAGAACTTAGGGGTGGGAGGAGGGTATAAATACGGAAT-GCAGCTGTATCTTGTCTCC | 81 | 5'-GCTGTGTGACTCCTGCAA-N43-GCAGCTGTATCTTGTCTCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Antigen 85 (Ag85A) (FbpA) | Identify aptamers that bind to and develop a graphene oxide-based fluorometric assay to detect FbpA. | N/A | 12 | Flow Cytometry | 202 nM | Biosensor | Magnetic Bead (MB)-based Protein SELEX | ATTO647N-labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0834 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN08 | ATGAGAGCGTCGGTGTGGTAACTTAATCCTCTAGTTTTAATTCTAGATACGGCGCATGCACTCTATGTAGGAGGGTGCGGAAGTA | 85 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 54.9 ± 7.8 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0835 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN27 | ATGAGAGCGTCGGTGTGGTAACTAGTCTGATTTCTATTTCCTTTAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA | 86 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 28.5 ± 4.9 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0836 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN27.SH | TAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA | 43 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 26.9 ± 5.6 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0837 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN08.SH | ATGCACTCTATGTAGGAGGGTGCGGA | 26 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 52.9 ± 10.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0838 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN17.SH | ATCCTCCTATCTATCGGTAGTTGTAGGAGGGTGCGG | 36 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 29 ± 7.3 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0839 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN21.SH | AGAGCGTCGGTGTGGTAACTGTTCAGGAGGATGACATTGTCGCCT | 45 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 18.1 ± 3.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0840 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St17Lp21 | ATCCTCCTAGGTAACTGTTCAGGATGTAGGAGGGT | 35 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 16.9 ± 3.9 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0841 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St21Lp17 | AAGCGTCGGTGTTCTATCGGTAGTTGACACCGACGCCT | 38 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 13.5 ± 2 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0842 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St08Lp17 | ATGCACTCTTCTATCGGTAGTTGAGGGTGCGG | 32 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 12.5 ± 2.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0843 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-6 | CGTGATGATGTTGAGTTG-GGGTGATGGGTGCATGTGATGAAAGGGGTTCGTGCTATGCTGTTTTGTCTAATAATACTAGTCCTTGCCAAGGTTTATTC-CAGTAATGCCAACCAATCT | 117 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | 66.26% fluorescent cell intensity for E. coli O157 with less cross-reactivity. | 10 | Flow Cytometry | 107.6 ± 67.8 pM | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0844 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-5 | CGTGATGATGTTGAGTTG-GAGTTGCGTTGCTGAATGCATGGGCTGTACTAGGTTGGTGCTACTCTGTAATGTCTACTATTACTATTCCATCGCAACGTATACTG-CAGTAATGCCAACCAATCT | 123 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | 57.41% fluorescent cell intensity for E. coli O157 with less cross-reactivity. | 10 | Flow Cytometry | 120.4 ± 32.2 pM | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0845 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-1 | CGTGATGATGTTGAGTTG-GCCGAGATTGAAGCTGGTGACCATTGGCCTTACTGGGATGCTCTTGTGATTACTACTACTAATCGTTGTGAACGTAAATGC-CAGTAATGCCAACCAATCT | 118 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | N/A | 10 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0846 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-2 | CGTGATGATGTTGAGTTG-GTGTTAATCCGTGTATGCCATGAGACCGGTAAGTCCTATTTTCGCTCCTGGAATGGTACAAGCTCATGTCAAGATATACTC-CAGTAATGCCAACCAATCT | 118 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | N/A | 10 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0847 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-3 | CGTGATGATGTTGAGTTG-GGGCAGATCCGTGCACATGATCTTAGCCGTACGTGTTCTGCGGTATAGTCTATTCATACTACCACTTCGCAATGTATATCG-CAGTAATGCCAACCAATCT | 118 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | N/A | 10 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0848 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-4 | CGTGATGATGTTGAGTTG-GTCGAGTACGGATCACTTGGAGATTGGCCATCGAGCTATTCTGTAATGTGTAATCCTACTACACCTTCGCATCGTTAATGC-CAGTAATGCCAACCAATCT | 118 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | N/A | 10 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0849 | 28941453 | 2017 | Development of a DNA Aptamer for Screening Neisseria meningitidis Serogroup B by Cell SELEX | K3 | GCCTGTTGTGAGCCTCCTAACGCCAGGCGTTTTGGCCGTAGGCGTGGGAGACAAGAATAAGCA | 63 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Neisseria Meningitidis Serogroup B (ATCC 13090) | Whole cell | Identity aptamers bind to and detect N. meningitidis in patients’ CSF samples. | Detected 10(2) CFU of CSF isolated N. meningitidis. | 6 | Flow Cytometry | 28.3 ± 8.9 pM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0850 | 28941453 | 2017 | Development of a DNA Aptamer for Screening Neisseria meningitidis Serogroup B by Cell SELEX | K4 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Neisseria Meningitidis Serogroup B (ATCC 13090) | Whole cell | Identity aptamers bind to and detect N. meningitidis in patients’ CSF samples. | N/A | 6 | Flow Cytometry | 39.1 ± 8.6 pM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0851 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-5 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | Display a LOD of 10(4) with a linear range from 10(4) to 10(7) cfu/mL. | 12 | Flow Cytometry | 10.69 ± 0.89 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0852 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-2 | AGCAGCACAGAGGTCAGATG-GCCTGGCCAGGTGCCCCGATATAGCGACGCCTTGCCCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0853 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-4 | AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCCCGTGAGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0854 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-12 | AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0855 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-1 | AGCAGCACAGAGGTCAGATG-CGCCCTACACCACTCTCGGAGCGCTGTACGGCATCCCTGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0856 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-15 | AGCAGCACAGAGGTCAGATG-GCCCGCACCACACACAGATGTCCATGTGTGCGCTGCCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0857 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-11 | AGCAGCACAGAGGTCAGATG-GCCTGGCCAGGTGCCCCGATATAGCGACGCCTTGCCCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0858 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-23 | AGCAGCACAGAGGTCAGATG-GCCTGGCCAGGTGCCCCGATATAGCGACGCCTTGCCCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0859 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-14 | AGCAGCACAGAGGTCAGATG-GCCTGGCCAGGTGCGCCGATATAGCCTGCCCTTGCCCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0860 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-18 | AGCAGCACAGAGGTCAGATG-GCCTGGCCACGTGCGCGGATATAGCCTGCCCTTGGCCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0861 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-9 | AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCCCGTGAGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0862 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-25 | AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCCCGTGAGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0863 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-28 | AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCCCGTGAGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0864 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-7 | AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCGGGTGAGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0865 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-6 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0866 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-17 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0867 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-21 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0868 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-26 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0869 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-27 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0870 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-30 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0871 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-29 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCGGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0872 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-3 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCGGGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0873 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-13 | AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0874 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-16 | AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0875 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-22 | AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0876 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-24 | AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0877 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-19 | AGCAGCACAGAGGTCAGATG-GTCACACGGCCCGTCTGCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0878 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-20 | AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTCTGGCACGCCGGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0879 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-8 | AGCAGCACAGAGGTCAGATG-GCCCGCGCCCCTTCTGCCGTTGGTCGGAACCCCTGTGCGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0880 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-10 | AGCAGCACAGAGGTCAGATG-GCCCGCGCGGGTTCTGCCGTTGGTGGGAACCCCTGTGCGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0881 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB2p | AGCAGCACAGAGGTCAGATG-CCGGGCAGCGGTCAATGCCGCACCTTCCATATGATCGGGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | The per cent gated fluorescence intensity above the background was 8.9% for BB2p. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0882 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10p | AGCAGCACAGAGGTCAGATG-GGCCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | The per cent gated fluorescence intensity above the background was 11.2% for BB10p. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0883 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16p | AGCAGCACAGAGGTCAGATG-CTCCCAGGCCGTTGGGGCGTTGCCTGCGTGCACCCGGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | The per cent gated fluorescence intensity above the background was 7.0% for BB16p. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0884 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB2 | CCGGGCAGCGGTCAATGCCGCACCTTCCATATGATCGGGG | 40 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | BB2 showed a lower binding affinity than the aptamer BB2p. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0885 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10 | GGCCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC | 40 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | Demonstrated higher binding affinity than the original full-length aptamer. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0886 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16 | CTCCCAGGCCGTTGGGGCGTTGCCTGCGTGCACCCGGGGC | 40 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | Demonstrated higher binding affinity than the original full-length aptamer. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0887 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-6f | GGCCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTT | 34 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0888 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-10f | GGCCCCCTGCCTGCCAAAAAGGTGTTGCCA | 30 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0889 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-14f | GGCCCCCTGCCTGCCAAAAAGGTGTT | 26 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0890 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-2r | CCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC | 38 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0891 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-9r | CCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC | 31 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0892 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-13r | CCAAAAAGGTGTTGCCAGGTTGGCGGC | 27 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0893 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16-11f | CTCCCAGGCCGTTGGGGCGTTGCCTGCGT | 29 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | LOD of the assay was 1000 cfu/mL with a linear range from 10(3) to 10(7) cfu/mL. | 12 | Flow Cytometry | 18.66 ± 1.41 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0894 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16-13f | CTCCCAGGCCGTTGGGGCGTTGCCTGC | 27 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0895 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16-15f | CTCCCAGGCCGTTGGGGCGTTGCCT | 25 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0896 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16-8r | CCGTTGGGGCGTTGCCTGCGTGCACCCGGGGC | 32 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1012 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB10 | TAGCTCACTCATTAGGCAC-TCGAGAGGGATCTCGGGGCGTGCGATGATTTTGCCTTCAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | A dual-labelled sandwich detection system was developed using biotinylated RAB10 and FITC-labelled RAB35, with a limit of detection (LOD) of 10^2 CFU/mL of S. aureus, and showed 2.7-fold more signal than other bacteria. | 10 | Flow Cytometry | 46 ± 24 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1013 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB20 | TAGCTCACTCATTAGGCAC-GCGTTACGTTAGTGGCCGCCTATGAGGACAGGCGGTTGTA-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 128 ± 45 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1014 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB28 | TAGCTCACTCATTAGGCAC-TGGACGTCGTGGCGGAGGTTTTATAAAACGGCGCCACTGT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 49 ± 39 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1015 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB35 | TAGCTCACTCATTAGGCAC-GGGGGGTTGTGCCATTTAAGATGACCGGTTGCCGCGATTT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | A dual-labelled sandwich detection system was developed using biotinylated RAB10 and FITC-labelled RAB35, with a limit of detection (LOD) of 10^2 CFU/mL of S. aureus, and showed 2.7-fold more signal than other bacteria. | 10 | Flow Cytometry | 34 ± 5 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1016 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB1 | TAGCTCACTCATTAGGCAC-CGGGTGGGCTCCAATATGAATCGCTTGCCCTGACGCTATCT-GCATAGTTAAGCCAGCC | 77 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 56 ± 87 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1017 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB3 | TAGCTCACTCATTAGGCAC-CGTAGTCTAGTGTCGATTAGTTTCCTTGAGACCTTGTGCT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 37 ± 112 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1018 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB5 | TAGCTCACTCATTAGGCAC-CGTAGTCTAGTGTCGATTAGTTTCCTTGCTATTGCAGACCTTGTGCT-GCATAGTTAAGCCAGCC | 83 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 58 ± 14 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1019 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB9 | TAGCTCACTCATTAGGCAC-TCGAGAGGGATCTCGGGGCGTGCGATGATTTTGCCTTCAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1020 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB21 | TAGCTCACTCATTAGGCAC-GGGGGGTTGTGCCATTTAAGATGACCGGTTGCCAAGATG-GCATAGTTAAGCCAGCC | 75 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1021 | 29098517 | 2018 | Influence of aptamer-targeted antibiofilm agents for treatment of Pseudomonas aeruginosa biofilms | PA-ap1 (F23) | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Aptamer-ciprofloxacin-SWNTs complex for antibiofilm activity. | 90% inhibitory efficiency of complex aptamer-ciprofloxacin-SWNTs on biofilm formation. | 16 | Flow Cytometry | 17.27 ± 5.00 nM | Targeted Delivery/Therapeutics | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1029 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-12 | AGCAGCACAGAGGTCAGATG-GCGGGCGGGGGGAGGGCGGCCGTGGGCTGCGAGTGGGAGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | Limit of detection of 70 cfu/mL with a range of 70–7100 cfu/mL. | 12 | Flow Cytometry | 44 ± 5 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1030 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-2 | AGCAGCACAGAGGTCAGATG-GTTCGGGGTCGGGGTGAGTGGGGCCTAGGAGTGGGGGCGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1031 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-8 | AGCAGCACAGAGGTCAGATG-ATGGGGGGCGGGGAGGTGGGTACAGGGTCGGGGATGGCAG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1032 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-10 | AGCAGCACAGAGGTCAGATG-CGGGCGGGGCGTGGGGTGTTGGAGTGGAGGGCGGGGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | 54 ± 8 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1033 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-15 | AGCAGCACAGAGGTCAGATG-CAGGGTGCGGGAGGGCCAAAGGGGGGAGGGCCCGGGGGGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1034 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-21 | AGCAGCACAGAGGTCAGATG-GGGGGAGGCGCCGGGCAGGGGGCTCGGGGGAGGCGGGCGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1035 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-26 | AGCAGCACAGAGGTCAGATG-TTCAGGGCGGGGTAAACGGGAGGTGGGGGGGGCTTGGGAC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | 130 ± 24 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1036 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-28 | AGCAGCACAGAGGTCAGATG-TAATACTACCAACTTCTTTGCCTGGCGTAAGTAACAGTCA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | 132 ± 18 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1037 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-32 | AGCAGCACAGAGGTCAGATG-TACACAATGCTTCGATAATTGACGCTACTTCATTTTATTA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1048 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-2 | TCAGCACGT-ATAAGCATGAATTGACCAACCTAAACTTATTCATTTTCCAGCACCTCTAATATTACTGGC-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | 75% binding affinity to V. parahaemolyticus than to other foodborne bacteria (less than 18%). | 8 | Flow Cytometry | 10.3 ± 4.5 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1049 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-1 | TCAGCACGT-AGCCCTATTTGTTTTCTCTTGTCTCTGTACTGCTGATGTTGGTCATTCTCTTTTCTCGGT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 19.2 ± 2.8 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1050 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-3 | TCAGCACGT-TATCTAGTCAGATATCCAGACAGTCGCGGCTGGAAGCTTCTGTTAAGAATTTGAGATACT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 25.2 ± 3.1 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1051 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-4 | TCAGCACGT-GCGGGCATTATTGCACTCCACGGCGAGTAGTGCTCACAGAGTCATTTACACCGGTCGTAT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 17.2 ± 5.1 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1052 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H7 | Apt-1 | TGAGCCCAAGCCCTGGTATG-TTACAGTATGCTACCTCTACTTGAAGGTTGGTCGACGCGG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 18.97 ± 1.73 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1053 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H8 | Apt-2 | TGAGCCCAAGCCCTGGTATG-TGATCGGTGACGAGGGTGCGGGGCGGGGGGTGAGGCACAG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 20.73 ± 2.29 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1054 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H9 | Apt-3 | TGAGCCCAAGCCCTGGTATG-TAGTAATGGTGCGTACAGGCGACGGGGTCCAGGCTGGAGG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 16.44 ± 2.16 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1055 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H10 | Apt-4 | TGAGCCCAAGCCCTGGTATG-AGCCCACGGAACACTGGTCGCGCCCACTGGTTTCTATATT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 15.13 ± 0.88 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1056 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H11 | Apt-5 | TGAGCCCAAGCCCTGGTATG-CGGATAACGAGGTATTCACGACTGGTCGTCAGGTATGGTT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | Apt-5 shows a strong affinity for all stages of bacterial growth (adjustment, log, and stationary phases). | 14 | Flow Cytometry | 9.04 ± 2.08 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1057 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H12 | Apt-6 | TGAGCCCAAGCCCTGGTATG-GTGTGCCTGTCGTTGTATTGGTCGGTAGGGATCGGAGTGG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 36.67 ± 4.55 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1058 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H13 | Apt-7 | TGAGCCCAAGCCCTGGTATG-TGTGGGGTCCTGGATTATGTTTAGCGTCTTTCGCAGTGGG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 17.11 ± 0.31 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1059 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H14 | Apt-8 | TGAGCCCAAGCCCTGGTATG-TCACATCCGGGTTCTTTGCGAACGCGTTTCCGCAGTCTCA-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 24.68 ± 1.95 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1060 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H15 | Apt-9 | TGAGCCCAAGCCCTGGTATG-TTGCGGGAGTCTAGCGGGCCACACTTTTATAGGTTCGCAG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 20.99 ± 0.37 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1226 | 31403764 | 2019 | Rapid Detection of Mycoplasma-Infected Cells by an ssDNA Aptamer Probe | Aptamer A15-1 | GTGGGGTTGAAAACGCCGGAGAGGGTGTGTGGGTGGGGTA | 40 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Mycoplasma-Infected Cells (Jeko-1 lymphoma cells) | Whole cell | Develop an aptamer probe for the rapid detection of mycoplasma-infected cells. | Mycoplasma-positive cells showed a strong signal, but no signal was detected in the mycoplasma-negative cells. | 15 | Flow Cytometry | 24.5 nM | Detection | Whole Cell-SELEX | 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1258 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A3P | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | Exhibits a wide linear detection range (from 10(2) to 10(7) cfu/mL), and the detection limit could be as low as 10 cfu/mL. | N/A | Flow Cytometry | 50.76 ± 8.92 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1259 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 32.53 ± 6.86 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1260 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A2 | GCAAAGAAACAGTGACTCGTTGA | 23 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 37.44 ± 6.98 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1261 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A3 | GCAACGAAACAGTGACTCGTTGA | 23 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 34.61 ± 3.47 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1262 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4 | CAACGAAACAGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 28.65 ± 3.05 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled and 5'-Biotinylated (Biotin-TTTTTTTTT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1263 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A5 | AACGAAACAGTGACTCGTT | 19 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 422.0 ± 21.93 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1264 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A6 | ACGAAACAGTGACTCGT | 17 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 412.9 ± 27.12 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1265 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-1 | CAACGAAACATTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1004 ± 187.1 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1266 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-2 | CAACGAAACAGTTACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1103 ± 180.2 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1267 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-3 | CAACGAAACTGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 958.9 ± 183.1 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1268 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-4 | CAACGAAACAGCGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1070 ± 73.05 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1269 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-5 | CAACGAAACAGTGTCTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1119 ± 187.1 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1270 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-6 | CAACGAAATAGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1070 ± 125.4 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1271 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-7 | CAACGAACCAGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 423.2 ± 36.91 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1272 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-8 | CAACGATACAGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 467.0 ± 33.38 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1273 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-9 | CAACGAAACAGTGAGTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 376.4 ± 54.25 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1284 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA1 | GACGCTTACTCAGGTGTGACTCG-TCCATACCTCCTATTCCTATCTGATCACCATGAGCTCTCGCCTGAACTGG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1285 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA2 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | VA2 could recognize different V. alginolyticus prevalent in Beibu Gulf with high specificity and affinity. | 9 | Flow Cytometry | 14.31 ± 4.26 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | No cytotoxic effects shown in vitro and in vivo. | N/A | Best Candidate | N/A | N/A |
| ABdb_1286 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA3 | GACGCTTACTCAGGTGTGACTCG-TATCTTGTCAGCATATAGCCGCCCTGTCTCGTGCCTCTAATTGGGCTTGT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1287 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA4 | GACGCTTACTCAGGTGTGACTCG-CTTGGTGGGGGGTGGCGGGTTGGTGATTAGTTGCGTGTACAACCGTTGCG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1288 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA5 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1289 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA6 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1290 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA7 | GACGCTTACTCAGGTGTGACTCG-GGGGCACTCTGGGGAAGGACGTAAGCGATAGCCGACCTCGTGGAATATTA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1291 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA8 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | VA8 could recognize different V. alginolyticus prevalent in Beibu Gulf with high specificity and affinity but less potent than VA2. | 9 | Flow Cytometry | 90.00 ± 13.51 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | No cytotoxic effects shown in vitro and in vivo. | N/A | Best Candidate | N/A | N/A |
| ABdb_1292 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA9 | GACGCTTACTCAGGTGTGACTCG-TCACCGTCATACACGGTCACCTGTTCTGCTATCACCCTGACGTGATTGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1293 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA10 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1294 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA11 | GACGCTTACTCAGGTGTGACTCG-TGGCGCAAGGGAAGGTGTTGGGGGATGGTTGGTGGGGTGTGTGGTTGTAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1295 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA12 | GACGCTTACTCAGGTGTGACTCG-ATGGCTGACTATATAAGAGAACGGGGGCTGCGGTGGTCCCGATCTGGCAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1296 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA13 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1297 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA14 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1298 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA15 | GACGCTTACTCAGGTGTGACTCG-TGGCGATGTACGCACCGCCCTCAGACTCATTCAGCATATAGCCTAGTAAC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1299 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA16 | GACGCTTACTCAGGTGTGACTCG-GGGGTGGATTGGGTGGGGTGGTTGGTTCGTTTTAAAGTACTGTGTAAGCG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1300 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA17 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1301 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA18 | GACGCTTACTCAGGTGTGACTCG-GCTGCGTTAACATATAGGGCATTTGAGTGCGCGCATAGGGTTGTGGCGAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1302 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA19 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1303 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA20 | GACGCTTACTCAGGTGTGACTCG-TCCAGTCAGTATATAACTCCTCGACCCTGTGATCGGCTACGGTGGCAGTA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1304 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA21 | GACGCTTACTCAGGTGTGACTCG-GAGTGCTCGGTTGGTGTTGGGGGAGGGTGGTGGGTGACCATGCTACATGT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1305 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA22 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1306 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA23 | GACGCTTACTCAGGTGTGACTCG-GGGCGGGTGGACGGGGGTGGTATGGAGGTTGGAGTAAGCGGTTTCACCGA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1307 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA24 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1308 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA25 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1309 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA26 | GACGCTTACTCAGGTGTGACTCG-TCTGGTAGCATATAGCCGGCAGAGCACGGTCCCCTCATGGTTGGCACGTA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1310 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA27 | GACGCTTACTCAGGTGTGACTCG-GCCATGCTCACTATATAAGATATGTAAGTTGGACTACATATGTATGGCTG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1311 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA28 | GACGCTTACTCAGGTGTGACTCG-GCTGTGATCGTATGGACGCTGCAGTTGGATGACGCTATGAGGTATTCCAA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1312 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA29 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1313 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA30 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1314 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA31 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1315 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA32 | GACGCTTACTCAGGTGTGACTCG-CACTATTGTCAAGTCACGAGTTAGGTACCTATGTGATCTGAGGTATCAA-CGAAGGACGCAGATGAAGTCTC | 94 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1316 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA33 | GACGCTTACTCAGGTGTGACTCG-CTACTCAGGTGACCCTCAAACGTATCTAGTTTGGCAGCGAGGTTCCTTCG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1317 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA34 | GACGCTTACTCAGGTGTGACTCG-TTGCGAATATAGCGACGAGTATCGTCAGAGTCGCCGGGTCCAGGTTCGA-CGAAGGACGCAGATGAAGTCTC | 94 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1318 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA35 | GACGCTTACTCAGGTGTGACTCG-GGTGGTGGGGATTTGGGGTGGTTGGTTCATCTATCTGGTCGTTACCGGGG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1319 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA36 | GACGCTTACTCAGGTGTGACTCG-CGCGGCACCAGCACGACGGTTCGATTGGCTGCGGAAACCACGCACTGCAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1320 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA37 | GACGCTTACTCAGGTGTGACTCG-GGTGTTGGTGGGTGGCGGGGTGGTGGTTGGTGTTCCCGAACCTGATGAAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1321 | 31563315 | 2019 | Rapid identification and quantitation of the viable cells of Lactobacillus casei in fermented dairy products using an aptamer-based strategy powered by a novel cell-SELEX protocol | Apt-1 | ATCGTATACCTAGAAGATATGACCGGCAGTTGATGAGATAGAGGCGCTGGTGGGTAGATA | 60 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Lactobacillus Casei (ATCC 393) | Whole cell | An aptamer-based strategy using PEG and chitosan-modified graphene oxide, with complementary ring-mediated RCA, was developed for qualitative and quantitative detection of viable L. casei in dairy products. | N/A | 8 | Flow Cytometry | 21.1 ± 2.7 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1322 | 31563315 | 2019 | Rapid identification and quantitation of the viable cells of Lactobacillus casei in fermented dairy products using an aptamer-based strategy powered by a novel cell-SELEX protocol | Apt-2 | GGCTCACCTACAGGCTGCGGAGTCATAGCATCGTGACAGAGTCGAGTGTCGACTATACGT | 60 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Lactobacillus Casei (ATCC 393) | Whole cell | An aptamer-based strategy using PEG and chitosan-modified graphene oxide, with complementary ring-mediated RCA, was developed for qualitative and quantitative detection of viable L. casei in dairy products. | Achieved a detection limit of 10(5) cfu/mL and selective detection of L. casei in commercial dairy drinks, with a dynamic range of 10(5) to 10(9) cfu/mL. | 8 | Flow Cytometry | 19.3 ± 3.7 nM | Detection | Whole Cell-SELEX | 3'-Biotinylated (biotin-AAAAAAAAAA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1323 | 31563315 | 2019 | Rapid identification and quantitation of the viable cells of Lactobacillus casei in fermented dairy products using an aptamer-based strategy powered by a novel cell-SELEX protocol | Apt-3 | TCGAAGTGAGCGCGCGGTGTGGTGACTGTGTTGCAGATGGATGCATGGAGGTGATGATGA | 60 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Lactobacillus Casei (ATCC 393) | Whole cell | An aptamer-based strategy using PEG and chitosan-modified graphene oxide, with complementary ring-mediated RCA, was developed for qualitative and quantitative detection of viable L. casei in dairy products. | Achieved a detection limit of 10(5) cfu/mL and selective detection of L. casei in commercial dairy drinks, with a dynamic range of 10(5) to 10(9) cfu/mL. | 8 | Flow Cytometry | 15.6 ± 4.1 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1367 | 32499557 | 2020 | Identification of two aptamers binding to Legionella pneumophila with high affinity and specificity | R10C5 | GCAATGGTACGGTACTTCCGGACAGTGCTGAAAACTGTGACCCCCCAAAAGTGCACGCTACTTTGCTAA | 69 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Legionella Pneumophila (Lp 120292) | Whole cell | Identify an aptamer against Lp and utilise it as a biorecognition element in a biosensor to detect Lp in real-time and in situ. | Around 60% of lp120292 cells are stained by R10C5 and 20% of Pseudomonas strains. | 10 | Flow Cytometry | 116 nM | Biosensor | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | Patent application no US 16/850,355 |
| ABdb_1368 | 32499557 | 2020 | Identification of two aptamers binding to Legionella pneumophila with high affinity and specificity | R10C1 | GCAATGGTACGGTACTTCCCCACCCCACGCTGCTCCCAAAAGTGCACGCTACTTTGCTAA | 60 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Legionella Pneumophila (Lp 120292) | Whole cell | Identify an aptamer against Lp and utilise it as a biorecognition element in a biosensor to detect Lp in real-time and in situ. | R10C1 shows significantly more binding to Lp than to Pseudomonas. | 10 | Flow Cytometry | 135 nM | Biosensor | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | Patent application no US 16/850,355 |
| ABdb_1415 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V8 | AGTATACGTATTACCTGCAGC-CAATCATGACCGCCCACCTCACTCG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell (Cell wall protein) | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | The LOD of the V8 from cytometry is 29.96 CFU/mL, and the linear range is 102–5 × 105 CFU/mL. | 13 | Flow Cytometry | 11.22 ± 1.30 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | V8 and V13 can tolerate diluted serum as well as oyster infusion. | Best Candidate | N/A | N/A |
| ABdb_1416 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V9 | AGTATACGTATTACCTGCAGC-CCTGGACATCATTGAGTACTCGTCT-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1417 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V11 | AGTATACGTATTACCTGCAGC-TCCCAACCAATACCAGTACGTTGTA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1418 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V12 | AGTATACGTATTACCTGCAGC-TATGGATTTGCGTCATGTTTATGTG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1419 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V13 | AGTATACGTATTACCTGCAGC-CCAACCCTATGCTTCAACGGTCTTT-GCAAAGATCTCCGAGATATCG | 67 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | 15.47 ± 0.39 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | V8 and V13 can tolerate diluted serum as well as oyster infusion. | Best Candidate | N/A | N/A |
| ABdb_1420 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V18 | AGTATACGTATTACCTGCAGC-TGTGGGTGGGTGGGTGGTATCTGCA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1421 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V20 | AGTATACGTATTACCTGCAGC-CATCCCCTCTCCTGTTGCCCTGACA-GCAAAGATCTCCGAGATATCG | 67 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1422 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V28 | AGTATACGTATTACCTGCAGC-CCTGGACATCATTGAGTACTCGTCT-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1423 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V31 | AGTATACGTATTACCTGCAGC-TGTGGGTGGGATTAGGTTCGGGTGG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1424 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V38 | AGTATACGTATTACCTGCAGC-CCAGACTTCAATCGCGTCAACCGTT-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1425 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V39 | AGTATACGTATTACCTGCAGC-TGATGGTTGTATGACTGGATGTCAA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1426 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V40 | AGTATACGTATTACCTGCAGC-TCCCCTTTGCATGGCGGTGACACTG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1427 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V41 | AGTATACGTATTACCTGCAGC-CACCTAGAACACATTGCAACATTAG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1428 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V44 | AGTATACGTATTACCTGCAGC-TGCTCCTCGACTGTTGTTAATCGTG-GCAGATCTCCGAGATATCG | 65 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1429 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V49 | AGTATACGTATTACCTGCAGC-TGACATCGTCTGACCTCCACAAGCA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1430 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V53 | AGTATACGTATTACCTGCAGC-TGGGTCCGTATGTTGGTGTATGTGA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1431 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V59 | AGTATACGTATTACCTGCAGC-TGTATACCCGACCGTACCGACGTAA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1432 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V69 | AGTATACGTATTACCTGCAGC-TCACCTTCACACACTCCCTTCTTCG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1433 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V71 | AGTATACGTATTACCTGCAGC-CCTGTACAAGCAGTATGTCAGCTGA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1434 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | TV8 | CAATCATGACCGCCCACCTCACTCG | 25 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | The fluorescent intensity of V. vulnificus was significantly greater than that of other species. | 13 | Flow Cytometry | 17.44 ± 1.30 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1435 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | TV13 | CCAACCCTATGCTTCAACGGTCTTT | 25 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | The fluorescent intensity of V. vulnificus was significantly greater than that of other species. | 13 | Flow Cytometry | 13.21 ± 2.19 nm | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1441 | 32471128 | 2020 | Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell Culture | A15-1 | GTGGGGTTGAAAACGCCGGAGAGGGTGTGTGGGTGGGGTA | 40 | N/A | ssDNA | Mycoplasma Hyorhinis | Mycoplasma hyorhinis-infected cells | Develop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines. | A15-1 could bind to M. hyorhinis, and mixed mycoplasma-infected cells were detectable within 30 min. | N/A | Flow Cytometry | N/A | Detection | N/A | 5'-Biotinylated and Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1442 | 32471128 | 2020 | Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell Culture | A16-1Y | TGGGTGGGGTTGTCGCTAGGGGTTTAAGGGGTCGTCGTGA | 40 | N/A | ssDNA | Mycoplasma Hyorhinis | Mycoplasma hyorhinis-infected cells | Develop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines. | A16-1Y could bind to M. hyorhinis and mixed mycoplasma-infected cells. | N/A | Flow Cytometry | N/A | Detection | N/A | 5'-Biotinylated and Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1443 | 32471128 | 2020 | Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell Culture | #1J | ATCCAGAGTGACGCAGCAGCCAACGTGCTTTCTACCTTATTTTCCGTCACTCTCACTCTGGACACGGTGGCTTAGT | 76 | N/A | ssDNA | Mycoplasma Hyorhinis | Mycoplasma hyorhinis-infected cells | Develop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines. | #1J could bind to unclassified mycoplasma-infected cells, but not M. hyorhinis-infected cells. | N/A | Flow Cytometry | N/A | Detection | N/A | 5'-Biotinylated and Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1476 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap1 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 18.10 ± 6.2 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1477 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap2 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 13.38 ± 3.8 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1478 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap3 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 11.46 ± 4.1 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1479 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap4 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 14.18 ± 4.3 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1480 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap5 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 21.78 ± 9.2 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1481 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap6 | TAGGGAAGAGAAGGACATATGAT-GCGCTGTGCGGATGTCATGATGTGCCTCTTCCCTGTGTCCGC-TTGACTAGTACATGACCACTTGA | 88 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | The detection limit of this aptasensor was as low as 10(5) CFU/ml within 10 minutes and a linear range of 10(5)-10(8) CFU/ml. | 10 | Flow Cytometry | 9.82 ± 3.6 nM | Biosensor | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1482 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap7 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 12.85 ± 4.1 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1483 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap8 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 32.90 ± 17.4 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1484 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap9 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 12.18 ± 4.3 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1485 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap10 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 32.85 ± 12.2 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1490 | 35516186 | 2020 | Selection of potential aptamers for specific growth stage detection of Yersinia enterocolitica | M1 | AGCAGCACAGAGGTCAGATGATATAACCTTAATAAATAAAATATAAATTATTTAATCTTACCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-TTCACGGTAGCACGCATAGG-3' | ssDNA | Yersinia Enterocolitica (CICC 21669) | Whole cell | Identified aptamers bound to the different growth stages of Y. enterocolitica. | Showed good affinity to all different stages of bacteria (adjustment phase, log phase, and pre-stationary phase). | 10 | Flow Cytometry | 37.93 ± 7.88 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1491 | 35516186 | 2020 | Selection of potential aptamers for specific growth stage detection of Yersinia enterocolitica | M5 | AGCAGCACAGAGGTCAGATGCTTGGTTCCACCGTACTGACTGTAGTAAAATCTGATCACTCCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-TTCACGGTAGCACGCATAGG-3' | ssDNA | Yersinia Enterocolitica (CICC 21669) | Whole cell | Identified aptamers bound to the different growth stages of Y. enterocolitica. | Showed good affinity to all different stages of bacteria (adjustment phase, log phase, and pre-stationary phase). | 10 | Flow Cytometry | 74.96 ± 21.34 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1492 | 35516186 | 2020 | Selection of potential aptamers for specific growth stage detection of Yersinia enterocolitica | M7 | AGCAGCACAGAGGTCAGATGTAGTCGGTCTTCTTGTTTGAAACTGCTAATTTTGAAAAAACCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-TTCACGGTAGCACGCATAGG-3' | ssDNA | Yersinia Enterocolitica (CICC 21669) | Whole cell | Identified aptamers bound to the different growth stages of Y. enterocolitica. | Showed good affinity to all different stages of bacteria (adjustment phase, log phase, and pre-stationary phase). | 10 | Flow Cytometry | 73.02 ± 18.76 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1494 | 32994896 | 2020 | Aptamer-nanobody based ELASA for detection of Vibrio cholerae O1 | V.ch27 | GCCTGTTGTGAGCCTCCTAAC-GGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCAC-CATGCTTATTCTTGTCTCC | 81 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Vibrio Cholerae O1 [Inaba (ATCC 39315) and Ogawa] | Whole cell | Identify aptamers and develop aptamer-nanobody-based ELISA for V. cholerae O1 detection. | The binding efficiency for V.ch27 was 53.3%. | 12 | Flow Cytometry | 20.186 ± 3.655 pM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1495 | 32994896 | 2020 | Aptamer-nanobody based ELASA for detection of Vibrio cholerae O2 | V.ch47 | GCCTGTTGTGAGCCTCCTAAC-CGTATTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTC-CATGCTTATTCTTGTCTCC | 79 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Vibrio Cholerae O1 [Inaba (ATCC 39315) and Ogawa] | Whole cell | Identify aptamers and develop aptamer-nanobody-based ELISA for V. cholerae O1 detection. | Identify 10(4) CFU/ml with 25 pM of biotinylated aptamer and only 20 μg/ml of VHH without any cross-reactivity. | 12 | Flow Cytometry | 15.404 ± 4.776 pM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1570 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI05 | TAGCTCACTCATTAGGCACGACTCACTCTTGAAGGGGTGAGGCATGGTGGTATCAGCATAGTTAAGCCAGCC | 72 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 144.4 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1571 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI08 | TAGCTCACTCATTAGGCACATGCACCGAGGTCAGAAGTGCCTGTAATACACACCCCTCGGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 301.4 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1572 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI 9 | TAGCTCACTCATTAGGCACCGAGTGCAAGATGTCCTACCCGATGAAGTAGGTTGGGTCTGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 279.7 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1573 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI23 | TAGCTCACTCATTAGGCACCTTGGCTTAAAATGATAGCTAGTGGCAGATTGTTAATTTGGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | The assay is able to detect 10(2) CFU/mL cells. | 10 | Flow Cytometry | 231.2 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1574 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI27 | TAGCTCACTCATTAGGCACATGGCAAGGTTGCCTTTTTGAGCGCGCTGCATAGTTAAGCCAGCC | 64 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 328.9 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1575 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI31 | TAGCTCACTCATTAGGCACCAGCCGGAAGGACCAGCTAGCTCACTCATTAGGCACCGAAGTGTGGTGCATAGTTAAGCCAGCC | 83 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 186.1 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1576 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI37 | TAGCTCACTCATTAGGCACGAACGGGCTTGTCTTTCCATAATTCGTGCGAAAGTGCCGCATAGTTAAGCCAGCC | 74 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 176.7 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1577 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI42 | TAGCTCACTCATTAGGCACTAGCGGAAGCTTAGTGTAAACGAGTGATAATGTGTTATGTGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 173.6 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1607 | 35846753 | 2022 | Selection and Identification of a DNA Aptamer for Multidrug-Resistant Acinetobacter baumannii Using an In-House Cell-SELEX Methodology | A01 | CAGGGGACGCACCAAGG-TTTTGTTTTTTCTTTGCTTCTTTTTGCTTTTTTTT-CCATGACCCGCGTGCTGCGTGA | 74 | 5'-CAGGGGACGCACCAAGG-N35-CCATGACCCGCGTGCTGCGTGAT-3' | ssDNA | Multidrug-resistant (MDR) Acinetobacter Baumannii | Whole cell | Identify aptamers against MDR A. baumannii. | Preferential binding to A. baumannii over other species. 25% of positive events for A. baumannii above the 12.66% of the negative control. | 7 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | Aptamer binding does not seem to interfere with the A. baumannii cell growth even after 24h (5.88E+02 x 1.45E+03; p=0.700). | N/A | N/A | N/A | N/A |
| ABdb_1673 | 35700936 | 2022 | SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers | EC1 | GGGGTCATAGTATCCTAGTTG-AATGATGACATTCCGAGGTACCCAGAGTGCGATACTAACCGGCCTGCTTG-CCTGTAATTTATCTTCTGGAGCT | 94 | 5'-GGGGTCATAGTATCCTAGTTG-N50-CCTGTAATTTATCTTCTGGAGCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 25922) | Lipopolysaccharide (LPS) | Identify aptamers that bind to LPS on Gram-negative bacteria and inhibit the LPS-induced inflammatory response, thereby inhibiting bacterial infections. | When aptamers bind to the LPS, the macrophage polarization ability of LPS can decrease, and the secreted nitrite level diminishes. | 8 | Flow Cytometry | 1.165 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1674 | 35700936 | 2022 | SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers | EC2 | GGGGTCATAGTATCCTAGTTG-CTCGCGCGCCCAATGTTTGCATCGATCTGATGGGCATAACGGCCTTGAAT-CCTGTAATTTATCTTCTGGAGCT | 94 | 5'-GGGGTCATAGTATCCTAGTTG-N50-CCTGTAATTTATCTTCTGGAGCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 25922) | Lipopolysaccharide (LPS) | Identify aptamers that bind to LPS on Gram-negative bacteria and inhibit the LPS-induced inflammatory response, thereby inhibiting bacterial infections. | When aptamers bind to the LPS, the macrophage polarization ability of LPS can decrease, and the secreted nitrite level diminishes. | 8 | Flow Cytometry | 10.26 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1675 | 35700936 | 2022 | SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers | EC3 | GGGGTCATAGTATCCTAGTTG-CCGACGAGACTTCCACAACGCTGCCAAGCCATCGTCCCCCCGCACTCAGG-CCTGTAATTTATCTTCTGGAGCT | 94 | 5'-GGGGTCATAGTATCCTAGTTG-N50-CCTGTAATTTATCTTCTGGAGCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 25922) | Lipopolysaccharide (LPS) | Identify aptamers that bind to LPS on Gram-negative bacteria and inhibit the LPS-induced inflammatory response, thereby inhibiting bacterial infections. | When aptamers bind to the LPS, the macrophage polarization ability of LPS can decrease, and the secreted nitrite level diminishes. | 8 | Flow Cytometry | 3.17 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1676 | 35700936 | 2022 | SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers | LM1 | GGGGTCATAGTATCCTAGTTG-CCGCCCGTAGAGGATTGTAGCCGCCTTTCGCCAACCTAAACCGAGACCTG-CCTGTAATTTATCTTCTGGAGCT | 94 | 5'-GGGGTCATAGTATCCTAGTTG-N50-CCTGTAATTTATCTTCTGGAGCT-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Lipopolysaccharide (LPS) | Identify aptamers that bind to LPS on Gram-negative bacteria and inhibit the LPS-induced inflammatory response, thereby inhibiting bacterial infections. | When aptamers bind to the LPS, the macrophage polarization ability of LPS can decrease, and the secreted nitrite level diminishes. | 8 | Flow Cytometry | 38.3 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1677 | 35700936 | 2022 | SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers | LM2 | GGGGTCATAGTATCCTAGTTG-TCGTTCATCTGAGCTCCTGGTATCGCGTGTGTATACGAGCCTCACATTCA-CCTGTAATTTATCTTCTGGAGCT | 94 | 5'-GGGGTCATAGTATCCTAGTTG-N50-CCTGTAATTTATCTTCTGGAGCT-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Lipopolysaccharide (LPS) | Identify aptamers that bind to LPS on Gram-negative bacteria and inhibit the LPS-induced inflammatory response, thereby inhibiting bacterial infections. | When aptamers bind to the LPS, the macrophage polarization ability of LPS can decrease, and the secreted nitrite level diminishes. | 8 | Flow Cytometry | 9.03 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1678 | 35700936 | 2022 | SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers | LM3 | GGGGTCATAGTATCCTAGTTG-CCGTCCCGGTAGTCTGAGCTTACAATGTCTGATTGGAAATGCACACCAAG-CCTGTAATTTATCTTCTGGAGCT | 94 | 5'-GGGGTCATAGTATCCTAGTTG-N50-CCTGTAATTTATCTTCTGGAGCT-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Lipopolysaccharide (LPS) | Identify aptamers that bind to LPS on Gram-negative bacteria and inhibit the LPS-induced inflammatory response, thereby inhibiting bacterial infections. | When aptamers bind to the LPS, the macrophage polarization ability of LPS can decrease, and the secreted nitrite level diminishes. | 8 | Flow Cytometry | 8.89 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1725 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA37 (SA-10R-37) | GCTTCCAGCTTATTGAAT-AAAGACGGGGGGGGGGACCGGCGTATGAGTGAAGATGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | Achieved a limit of detection (LOD) of 39 CFUs and 414 CFUs in buffer and spiked tap water samples, respectively, with the cognate pair of SA37@Cy5 and SA81@FAM. | 10 | Flow Cytometry | 16.5 ± 3.41 nM | Biosensor | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1726 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA81 (SA-10R-81) | GCTTCCAGCTATTGAA-AACGAGGCGCAGGGGGAGGGGGTGGTACAGATAAGATGGGG-GCGCTGAAGCGCGGAAGC | 75 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | Achieved a limit of detection (LOD) of 39 CFUs and 414 CFUs in buffer and spiked tap water samples, respectively, with the cognate pair of SA37@Cy5 and SA81@FAM. | 10 | Flow Cytometry | 14.47 ± 8.18 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1727 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA25 (SA-9R-25) | GCTTCCAGCTTATTGAAT-GGGGAAGGTCGTCCGACGAACCCGGTCAGATAGGGTGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 44.92 ± 1.36 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1728 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA28 (SA-10R-28) | GCTTCCAGCTTATTGAAT-GCGGCCACGGAGGGGGTGCCGGGCGTGGAATAAGATGTGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 77 ± 1.22 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1729 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA35 (SA-10R-35) | GCTTCCAGCTTATTGAAT-CACAGGTGTGGGGAGGTCCCCATGGAGGTGGTTCAATG-GCGCTGAAGCGCGGAAGC | 74 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 58.77 ± 0.73 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1730 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA40 (SA-10R-40) | GCTTCCAGCTTATTGAAT-CGACGTGAAGCAATCATGGGTGGGGTACGTCGGGTCATGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 126.95 ± 0.51 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1731 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-9R-12 | GCTTCCAGCTTTATGAAT-TGGGCGTGGCGACGGTGTCAGGTCGGGGCGGTAAGACGAGG-GCGCTGAAGCGCGGAAGC | 77 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1732 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-9R-57 | GCTTCCAGCTTATTGAAT-GGAACGAGATGGGGCATGGCGCCACGGAGGGGAATCAAGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1733 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-1 | GCTTCCAGCTTATTGAAT-CGAGGGTAAGGGAAGTATGGCCGGTGCCCTGGAGTCAATG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1734 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-18 | GCTTCCAGCTTATTGAAT-CGGGTGGGGGGAGCGACAGACGGAAAAGCCTGGGTCAATAG-GCGCTGAAGCGCGGAAGC | 77 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1735 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-55 | GCTTCCAGCTTATTGAAT-GGAGGGGCAGGGCATGGAGCTCGACATTCATGAGATGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1736 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-59 | GCTTCCAGCTTATGGAAT-GTGCCGAGGCGATACATGCACAGGCATGGTGGGATAAGGTCGGG-GCGCTGAAGCGCGGAAGC | 80 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1737 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-69 | GCTTCCAGCTTATTGAAT-CGGAGAGTCTGGCGCAGCCCTACGCCGATGTAAGATGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1738 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-72 | GCTTCCAGCTTATTGAAT-CGAGGTGTGGGAGACAACGCTCCGTGACCGAGGGGAAATG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1801 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B3 | AGCAGCACAGAGGTCAGATG-AGGCCCGGGTTTGGTTCTGGGGTTGGCGGGCTGCGTGAGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1802 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B4 | AGCAGCACAGAGGTCAGATG-GAAGGGTTTGGTGGTAAATTGCGTGGTTGGCTGTTGATGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1803 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B6 | AGCAGCACAGAGGTCAGATG-GGCGGGTTTGGATCTTTGGTTGGCGCTTGTTTCTTTATGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1804 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B7 | AGCAGCACAGAGGTCAGATG-TCGGTCGGGTTTGGGTGTTGGTTGGCGATAAAGATAACTG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | 19.64 ± 4.11 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1805 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B11 | AGCAGCACAGAGGTCAGATG-GTGTAGGTCAATCGACGCCACCCATAGCAACCATCCTGCG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1806 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B14 | AGCAGCACAGAGGTCAGATG-GTGGGCAGTGGGGGGAGGGGGAGGTGGAGGTTAGACGTGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | 28.64 ± 3.10 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1807 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B15 | AGCAGCACAGAGGTCAGATG-GGCGGGTTTGGATCTTTGGTTGGCGCCTGTTTCTTTATGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | Achieve highly sensitive detection of B. cereus as low as 10 cfu/mL. | 16 | Flow Cytometry | 16.13 ± 4.98 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1808 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B16 | AGCAGCACAGAGGTCAGATG-ATATGTTTACGCCAGTGGTATTATTGGGGTTGATATGTCA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | Achieve highly sensitive detection of B. cereus as low as 10 cfu/mL. | 16 | Flow Cytometry | 20.67 ± 5.23 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1810 | 37437266 | 2023 | Specific Instantaneous Detection of Klebsiella pneumoniae for UTI Diagnosis with a Plasmonic Gold Nanoparticle Conjugated Aptasensor | KPBA1 | GGCTGGATGGGGCGTGT-GGAGCCCCGTTAGAATATCAGAGGTGGTGG-CAACGGTGCGGACAGCG | 64 | 5'-GGCTGGATGGGGCGTGT-30N-CAACGGTGCGGACAGCG-3' | ssDNA | Klebsiella Pneumoniae (MTCC-7028) | Whole cell | Developed localized surface plasmon resonance (LSPR) aptasensor using a tailor-made plasmonic aptamer-gold nanoparticle (AuNP) for detection of Klebsiella pneumoniae. | LoD as low as 3.4 × 10(3) CFU/mL within 5 min. | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5′-Thiolated (5′-/5ThioMC6-D) and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1871 | 38669846 | 2024 | Ultra-sensitive and rapid detection of Salmonella enterica and Staphylococcus aureus to single-cell level by aptamer-functionalized carbon nanotube field-effect transistor biosensors | S. enterica aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an aptamer-functionalized CNT-FET biosensor for the detection of these foodborne pathogens. | Could detect S. enterica at a limit of detection (LOD) as low as 1 CFU in PBS buffer with a linear range from 62.5–6.4 × 10(4) CFU/mL. | N/A | Flow Cytometry | 8.9 ± 2.0 nM | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6), 5'-FAM Labeled and 3'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1872 | 38669846 | 2024 | Ultra-sensitive and rapid detection of Salmonella enterica and Staphylococcus aureus to single-cell level by aptamer-functionalized carbon nanotube field-effect transistor biosensors | S. aureus aptamer | AACGAGGCGCAGGGGGAGGGGGTGGTACAGATAAGATGGGG | 41 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CMCC(B) 26003) | Whole cell | Developed an aptamer-functionalized CNT-FET biosensor for the detection of these foodborne pathogens. | Could detect S. aureus at a limit of detection (LOD) as low as 1.2 CFU in PBS buffer with a linear range from 10(2)-1.28 × 10(4) CFU/mL. | N/A | Flow Cytometry | 0.65 ± 0.2 μM | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6), 5'-FAM Labeled and 3'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1883 | 41431270 | 2025 | Bioimaging with fluorescent nucleic-acid aptamers for the specific detection and quantification of Pseudomonas aeruginosa alone and in heterogeneous bacterial populations | F23 | ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT | 96 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15692) | Whole cell | Develop a fluorescent aptamer for detecting Pseudomonas aeruginosa. | 73.79% of live P. aeruginosa cells (3102/4204) were labeled by the Cy5‐F23 aptamer, compared to only 0.06% of live S. aureus (4/6767). | 15 | Flow Cytometry | 17.27 ± 5.00 nM | Imaging | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | The aptamer remains highly stable for 72 hours. | N/A | N/A | N/A |
| ABdb_1896 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S8 | CGTACGGTCGACGCTAGC-ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1897 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S10 | CGTACGGTCGACGCTAGC-ACCAGCCATAGTCACATCAAAACTAACTCACATTC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1898 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S12 | CGTACGGTCGACGCTAGC-CCCATACTCATCACCATTCACATCACTCACCTAGC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1899 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S1 | GGATCCGAGCTCCACGTG-GCTAGGTGAGTGATGTGAATGGTGATGAGTATGGG-GCTAGCGTCGACCGTACG | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S1, the Ru-modified oligonucleotide, bound S. pneumoniae R6 with slightly lower affinity than S9. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 125 ± 91 nM | Detection | SELEX and Mod-SELEX | T=dURu(bpy)TP1, 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1900 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S9 | ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S9 bound better to the bacterial target than the modified sequence S1. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 118 ± 1 nM | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1901 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S11 | ACCAGCCATAGTCACATCAAAACTAACTCACATTC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S11 exhibited a lower propensity at binding to the bacterial target. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 541 ± 1 nM | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1902 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S13 | CCCATACTCATCACCATTCACATCACTCACCTAGC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1958 | 20582587 | 2010 | Selection and characterization of DNA aptamers with binding selectivity to Campylobacter jejuni using whole-cell SELEX | ONS-23 | N/A | N/A | 5'-GTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Campylobacter Jejuni (A9a) | Whole cell (bind via proteinaceous nature for cell surface target) | Identify aptamers against C. jejuni and detect them in a mixed cell population. | ONS-23 showed high binding affinity (25–36%) for all other C. jejuni strains screened (inclusivity) and low apparent binding affinity (1–5%) with non-C. jejuni strains (exclusivity). | 10 | Flow Cytometry | 292.8 ± 53.1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | WO Patent WO/2011/097420 |
| ABdb_1964 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK2 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Significantly decreased macrophage invasion from 64.58% (without aptamers) to 33.02% (with 10th aptamer pool), and 26.01% (with NK2). | 10 | Flow Cytometry | 31 ± 4 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1965 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK1 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 48 ± 13 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1966 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK7 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 35 ± 9 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1967 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK8 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 107 ± 44 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1968 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK10 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 95 ± 28 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1969 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK20 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 55 ± 16 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2017 | 27151293 | 2016 | Identification of ssDNA aptamers specific to clinical isolates of Streptococcus mutans strains with different cariogenicity | H19 | N/A | N/A | 5'-GCAATGGTACGGTACTTCC-45N-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Streptococcus Mutans | Whole cell | Identify a high-affinity aptamer against cariogenic S. mutans strains. | Aptamer H19 showed strong binding, as indicated by higher fluorescence intensity, with Strains 12 and 17 compared with other strains. | 9 | Flow Cytometry | 69.45 ± 38.53 nM | Detection | Subtractive SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |