Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 31
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0343 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL1 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-GGCGCCATAGCGACGGGGCCATTCCAAGAA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | ZXL1 bound to virulent M. tb H37Rv much more strongly (52.2%) than to the other Mycobacteria strains tested, M. smegmatis (2.5%) and BCG (13.9%). LPS-stimulated human DC groups showed that ZXL1 decreased IL-10 production by 31–36% and increased IL-12 production by 52–91%, thereby reducing the progression of infection and bacterial loads in mice and rhesus monkeys. | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 436.3 ± 37.84 nM | Therapeutics/Immunmodulatory | SELEX | Biotinylated or FAM Labeled | ZXL1 showed no significant cytotoxicity at concentrations ranging from 2 to 15 microM at the 168-hour test. | N/A | Best Candidate | N/A | N/A |
| ABdb_0344 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL2 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-AGTCCACGATAATCACACACACGGACACCC-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0345 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL4 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CACGCCCAATAGTGGCTCCAGCTCATCTCT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0346 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL5 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CATCGATGTACCCTACCTACATGTTACGTT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0347 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL6 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-ACCTACAGCGACACCTAACTGAGTAGAACT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0348 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL7 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TACCTAACACTTCCTGCTCCACCTTTATTA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0349 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL8 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CCCTGATTCCCCCTCATCCGATGGACATCT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0350 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL9 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-GACCCTCATGATACCAACCACTCCAGTCAA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0351 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL10 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TATCCCAGTGGCATTAACTACCCACTCGCA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0352 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL3 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TCACGGAGTGAGGGGCTGTTCATTAAGAGA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0353 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL12 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TCGCCTGATAGGTCTGTGATCCAATCCAAT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0354 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL13 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TCTGCTTGCCGCTGATCCGCCAATTCGATC-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0355 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL14 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TCGTGCCGACGCTGCCGAATAGCACTGCAC-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0753 | 27529508 | 2016 | A Single ssDNA Aptamer Binding to Mannose-Capped Lipoarabinomannan of Bacillus Calmette-Guérin Enhances Immunoprotective Effect against Tuberculosis | BM2 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CCCCATGAACTAGGCTCCACAATGAGTTTGG-GGGTCAATGCGTCATA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N31-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Bovis (bacillus Calmette–Guérin (BCG)) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identified aptamers against ManLAM and served as an immune enhancer for BCG against M. tb H37Rv infection via blocking MR binding, triggering ManLAM–CD44 signalling, and enhancing M1 macrophage and Th1 activation via cellular surface CD44 in vitro and in vivo. | Ki of BM2 was estimated to be 10.34 ± 0.27 nM, with a LOD of 1 × 10^4 cfu/100 μL of BCG. | 10 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 8.59 ± 1.23 nM | Therapeutics/Immunmodulatory | SELEX | Biotinylated | BM2 was demonstrated to be safe with low toxicity based on in vitro and in vivo toxicity analyses. | BM2–BCG complex could be detected and remained stable for at least 30 days in vivo. | N/A | N/A | N/A |
| ABdb_0754 | 27529508 | 2016 | A Single ssDNA Aptamer Binding to Mannose-Capped Lipoarabinomannan of Bacillus Calmette-Guérin Enhances Immunoprotective Effect against Tuberculosis | BM1 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CGGTCGTAGACCGGGAGTTGTTGTTAGTTCA-GGGTCAATGCGTCATA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N31-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Bovis (bacillus Calmette–Guérin (BCG)) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identified aptamers against ManLAM and served as an immune enhancer for BCG against M. tb H37Rv infection via blocking MR binding, triggering ManLAM–CD44 signalling, and enhancing M1 macrophage and Th1 activation via cellular surface CD44 in vitro and in vivo. | N/A | 10 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0755 | 27529508 | 2016 | A Single ssDNA Aptamer Binding to Mannose-Capped Lipoarabinomannan of Bacillus Calmette-Guérin Enhances Immunoprotective Effect against Tuberculosis | BM4 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CGCGCAGCGGGTCGACTTCATTCCTCACCAT-GGGTCAATGCGTCATA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N31-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Bovis (bacillus Calmette–Guérin (BCG)) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identified aptamers against ManLAM and served as an immune enhancer for BCG against M. tb H37Rv infection via blocking MR binding, triggering ManLAM–CD44 signalling, and enhancing M1 macrophage and Th1 activation via cellular surface CD44 in vitro and in vivo. | N/A | 10 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0784 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8 | ATACCAGCTTATTCAATT-AGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | PA#2/8 and its truncated variant PA#2/8[S1-58] were able to differentiate between the highly Protein A-producing S. aureus Cowan strain. | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | 101.4 ± 5.9 nM (of 3′-biotinylated) and 189.9 ± 13.0 nM (of 5′-biotinylated) | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0785 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S1-58] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT | 58 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | PA#2/8 and its truncated variant PA#2/8[S1-58] were able to differentiate between the highly Protein A-producing S. aureus Cowan strain. | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | 11.3 ± 1.4 nM (of 3′-biotinylated) and 23.7 ± 2.0 nM (of 5′-biotinylated) | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0786 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S1-50] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTC | 50 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | N/A | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0787 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S1-43] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGG | 43 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | N/A | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0788 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S28-50] | AGGGGGATAGAGGGGGTGGGTTC | 23 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | N/A | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1849 | https://doi.org/10.1016/j.biosx.2023.100436 | 2024 | DNA origami-enhanced binding of aptamers to Staphylococcus aureus cells | PA#2/8 [1–58] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT | 58 | N/A | ssDNA | Staphylococcus aureus (S. aureus) SA5 | Staphylococcus aureus Protein A (SpA) | Developed a DNA origami-based biosensor for the detection of SA. | Five-times higher affinity of the aptamer-functionalized DNA origami compared to pure aptamers. | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | 160 ± 9 nM | Biosensor | N/A | 5'-PolyA (21A) or PolyT (21 T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2018 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T9 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | Specificity and sensitivity were 95.31% and 83.00% (for 100 aPTB serum samples), 98.70% and 92.71% (for 96 aPTB sputum samples), and 94.44% and 88.71% (for 62 EPTB serum samples), respectively. | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 668 ± 159 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2019 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T25 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 685 ± 131 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2020 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T14 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 815 ± 144 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2021 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T15 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 736 ± 207 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2022 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T6 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 998 ± 207 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2113 | https://doi.org/10.1016/j.snb.2017.02.098 | 2017 | Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators | PA05 | N/A | N/A | N/A | ssDNA | Streptococcus Pneumoniae | Surface-specific Protein PavA | Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis. | N/A | 8 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU)) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2114 | https://doi.org/10.1016/j.snb.2017.02.098 | 2017 | Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators | PA08 | N/A | N/A | N/A | ssDNA | Streptococcus Pneumoniae | Surface-specific Protein PavA | Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis. | The polyclonal population PA08 showed a frequency shift four times greater and a faster reaction rate than FH05 when measured on the gravimetric sensor. | 8 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU)) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2115 | https://doi.org/10.1016/j.snb.2017.02.098 | 2017 | Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators | FH05 | N/A | N/A | N/A | ssDNA | Neisseria Meningitidis | Surface-specific Protein FHbp | Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis. | The polyclonal population PA08 showed a frequency shift four times greater and a faster reaction rate than FH05 when measured on the gravimetric sensor. | 8 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU)) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2116 | https://doi.org/10.1016/j.snb.2017.02.098 | 2017 | Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators | FH08 | N/A | N/A | N/A | ssDNA | Neisseria Meningitidis | Surface-specific Protein FHbp | Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis. | N/A | 8 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU)) | N/A | N/A | N/A | N/A | N/A |