Determination of affinity method : Electrophoretic Mobility Shift Assay (EMSA)

Total records found: 16

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0067	19049862	2009	Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars	Aptamer 33	TTTGGTCCTTGTCTTATGTCCAGAATGC-TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG-ATTTCTCCTACTGGGATAGGTGGATTAT	96	5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3'	ssDNA	Salmonella Typhimurium (S. Typhimurium) DT104	Outer membrane protein (OMP)	Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium.	In a pull-down assay format, detection limits were 10¹–10² CFU S. Typhimurium/9 mL rinsate, while in a recirculation format, detection limits were 10²–10³ CFU/25 mL rinsate.	7	Electrophoretic Mobility Shift Assay (EMSA)	N/A	Biosensor	SELEX	5'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0068	19049862	2009	Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars	Aptamer 23	TTTGGTCCTTGTCTTATGTCCAGAATGC-CCGCCTTTACTAAATTGACGAACATAGGAATCAATGAAGC-ATTTCTCCTACTGGGATAGGTGGATTAT	96	5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3'	ssDNA	Salmonella Typhimurium (S. Typhimurium) DT104	Outer membrane protein (OMP)	Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium.	N/A	7	Electrophoretic Mobility Shift Assay (EMSA)	N/A	Biosensor	SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0069	19049862	2009	Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars	Aptamer 24	TTTGGTCCTTGTCTTATGTCCAGAATGC-GGGAGTCAGAACGCCTGGGCAAGCATAGTACTCGCCGGAA-ATTTCTCCTACTGGGATAGGTGGATTAT	96	5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3'	ssDNA	Salmonella Typhimurium (S. Typhimurium) DT104	Outer membrane protein (OMP)	Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium.	N/A	7	Electrophoretic Mobility Shift Assay (EMSA)	N/A	Biosensor	SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0070	19049862	2009	Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars	Aptamer 25	TTTGGTCCTTGTCTTATGTCCAGAATGC-TAAAGAGGAATCGACAGGCATCAGAGTCCGTAATGCGGGG-ATTTCTCCTACTGGGATAGGTGGATTAT	96	5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3'	ssDNA	Salmonella Typhimurium (S. Typhimurium) DT104	Outer membrane protein (OMP)	Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium.	N/A	7	Electrophoretic Mobility Shift Assay (EMSA)	N/A	Biosensor	SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0071	19049862	2009	Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars	Aptamer 45	TTTGGTCCTTGTCTTATGTCCAGAATGC-GAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAA-ATTTCTCCTACTGGGATAGGTGGATTAT	96	5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3'	ssDNA	Salmonella Typhimurium (S. Typhimurium) DT104	Outer membrane protein (OMP)	Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium.	N/A	7	Electrophoretic Mobility Shift Assay (EMSA)	N/A	Biosensor	SELEX	5'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1203	28882627	2018	Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile	anti-G1	CAGGTCCATCGAGTGGTA-GGAGGTATTTAGTGCCAAGCCATCTCAAACGACGTCTGAG-TCGCACTGCTCCTGAACGTAC	79	5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'	ssDNA	Clostridium Difficile	Glutamate dehydrogenase (GDH)	Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.	N/A	10	Electrophoretic Mobility Shift Assay (EMSA)	3.1 ± 1.2 nM	Detection	SELEX	5'-Radiolabelled ([γ-32P]-ATP-labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_1204	28882627	2018	Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile	anti-G3	CAGGTCCATCGAGTGGTA-TGCAGCGGACAGTGTGGGACCATCGCTGCGGATGTATGAA-TCGCACTGCTCCTGAACGTAC	79	5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'	ssDNA	Clostridium Difficile	Glutamate dehydrogenase (GDH)	Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.	N/A	10	Electrophoretic Mobility Shift Assay (EMSA)	5.6 ± 2.4 nM	Detection	SELEX	5'-Radiolabelled ([γ-32P]-ATP-labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_1205	28882627	2018	Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile	anti-G7	CAGGTCCATCGAGTGGTA-CCCAACCCACGATGCGCAAGAGGAATGCAGCCTACCAGCA-TCGCACTGCTCCTGAACGTAC	79	5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'	ssDNA	Clostridium Difficile	Glutamate dehydrogenase (GDH)	Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.	N/A	10	Electrophoretic Mobility Shift Assay (EMSA)	4.6 ± 1.6 nM	Detection	SELEX	5'-Radiolabelled ([γ-32P]-ATP-labeled)	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1206	28882627	2018	Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile	anti-G1-T1	TAGGAGGAGGTATTTAGTGCCAAGCCATCTCAAACGACGTCTGAGTCGCACTGCTCCTG	59	5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'	ssDNA	Clostridium Difficile	Glutamate dehydrogenase (GDH)	Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.	Achieved a detection limit of 1 nM.	10	Electrophoretic Mobility Shift Assay (EMSA)	4.5 ± 2.2 nM	Detection	SELEX	5'-Radiolabelled ([γ-32P]-ATP-labeled) and 5'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1207	28882627	2018	Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile	anti-G2	CAGGTCCATCGAGTGGTA-CCGAGTTCCCAATATTATGGCTATGCAGGATACTTCACCT-TCGCACTGCTCCTGAACGTAC	79	5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'	ssDNA	Clostridium Difficile	Glutamate dehydrogenase (GDH)	Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.	N/A	10	Electrophoretic Mobility Shift Assay (EMSA)	N/A	Detection	SELEX	5'-Radiolabelled ([γ-32P]-ATP-labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_1208	28882627	2018	Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile	anti-G4	CAGGTCCATCGAGTGGTA-TGAGTACTAGTTCCCCAGGAGAAAGCAGATCCCCAGGTAC-TCGCACTGCTCCTGAACGTAC	79	5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'	ssDNA	Clostridium Difficile	Glutamate dehydrogenase (GDH)	Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.	N/A	10	Electrophoretic Mobility Shift Assay (EMSA)	N/A	Detection	SELEX	5'-Radiolabelled ([γ-32P]-ATP-labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_1209	28882627	2018	Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile	anti-G5	CAGGTCCATCGAGTGGTA-GCACAGGACGCAAGATGAATGCAGCATACCAGTCCCTAGA-TCGCACTGCTCCTGAACGTAC	79	5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'	ssDNA	Clostridium Difficile	Glutamate dehydrogenase (GDH)	Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.	N/A	10	Electrophoretic Mobility Shift Assay (EMSA)	N/A	Detection	SELEX	5'-Radiolabelled ([γ-32P]-ATP-labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_1210	28882627	2018	Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile	anti-G6	CAGGTCCATCGAGTGGTA-CAGCTGTCGACGCGTTACCGTGAACGGAACACCGATGACG-TCGCACTGCTCCTGAACGTAC	79	5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'	ssDNA	Clostridium Difficile	Glutamate dehydrogenase (GDH)	Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.	N/A	10	Electrophoretic Mobility Shift Assay (EMSA)	N/A	Detection	SELEX	5'-Radiolabelled ([γ-32P]-ATP-labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_1211	28882627	2018	Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile	anti-G8	CAGGTCCATCGAGTGGTA-TGCGTGATTGGACCAGGGAAAGATGCACCGCAAGACAAGA-TCGCACTGCTCCTGAACGTAC	79	5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'	ssDNA	Clostridium Difficile	Glutamate dehydrogenase (GDH)	Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.	N/A	10	Electrophoretic Mobility Shift Assay (EMSA)	N/A	Detection	SELEX	5'-Radiolabelled ([γ-32P]-ATP-labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_1212	28882627	2018	Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile	anti-G9	CAGGTCCATCGAGTGGTA-AGGATAATCCGATACGCAAGAAGAAAGCAGATTACCAGGA-TCGCACTGCTCCTGAACGTAC	79	5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'	ssDNA	Clostridium Difficile	Glutamate dehydrogenase (GDH)	Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.	N/A	10	Electrophoretic Mobility Shift Assay (EMSA)	N/A	Detection	SELEX	5'-Radiolabelled ([γ-32P]-ATP-labeled)	N/A	N/A	N/A	N/A	N/A
ABdb_1213	28882627	2018	Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile	anti-G10	CAGGTCCATCGAGTGGTA-CAAAGTCGGCAAGGTGGAAAGCAGCCACACCACGACTAGT-TCGCACTGCTCCTGAACGTAC	79	5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'	ssDNA	Clostridium Difficile	Glutamate dehydrogenase (GDH)	Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.	N/A	10	Electrophoretic Mobility Shift Assay (EMSA)	N/A	Detection	SELEX	5'-Radiolabelled ([γ-32P]-ATP-labeled)	N/A	N/A	N/A	N/A	N/A