Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0953 | 29160851 | 2017 | Development of An Impedimetric Aptasensor for the Detection of Staphylococcus aureus | PA#2/8[S1-58] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT | 58 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (DSM 20231) | Staphylococcus aureus Protein A (SpA) | Developed an impedimetric aptasensor for the detection of S. aureus. | Showed a limit of detection of 10 CFU/mL within 10 minutes. | N/A | Electrochemical impedance spectroscopy (EIS) | 18.5 ± 1.8 | Biosensor | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |