AptBacterialDB

Determination of affinity method : Colorimetric Peroxidase-Based Aptamer Plate Binding Assay

Total records found: 26

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0026 187591122008In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexesL1FATCCGTCACCCCTGCTCTCGTCGCTATGAAGTAACAAAGATAGGAGCAATCGGGTGGTGTTGGCTCCCGTAT725'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'ssDNAEscherichia Coli (E. Coli) O111:B4 and K12 strainsLipopolysaccharide (LPS) and Whole cellIdentify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0027 187591122008In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexesL3FATCCGTCACACCTGCTCTAACGAAGACTGAAACCAAAGCAGTGACAGTGCTGAATGGTGTTGGCTCCCGTAT725'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'ssDNAEscherichia Coli (E. Coli) O111:B4 and K12 strainsLipopolysaccharide (LPS) and Whole cellIdentify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0028 187591122008In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexesL4FATCCGTCACACCTGCTCTCGGTGACAATAGCTCGATCAGCCCAAAGTCGTCAGATGGTGTTGGCTCCCGTAT725'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'ssDNAEscherichia Coli (E. Coli) O111:B4 and K12 strainsLipopolysaccharide (LPS) and Whole cellIdentify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0029 187591122008In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexesL6FATCCGTCACACCTGCTCTAACGAAATAGACCACAAATCGATACTTTATGTTATTGGTGTTGGCTCCCGTAT715'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'ssDNAEscherichia Coli (E. Coli) O111:B4 and K12 strainsLipopolysaccharide (LPS) and Whole cellIdentify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0030 187591122008In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexesL7FATCCGTCACACCTGCTCTGTCGAATGCTCTGCCTGGAAGAGTTGTTAGCAGGGATGGTGTTGGCTCCCGTAT725'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'ssDNAEscherichia Coli (E. Coli) O111:B4 and K12 strainsLipopolysaccharide (LPS) and Whole cellIdentify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0031 187591122008In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexesL8FATCCGTCACACCTGCTCTTAAGCCGAGGGGTAAATCTAGGACAGGGGTCCATGATGGTGTTGGCTCCCGTAT725'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'ssDNAEscherichia Coli (E. Coli) O111:B4 and K12 strainsLipopolysaccharide (LPS) and Whole cellIdentify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0032 187591122008In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexesL9FATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTAT725'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'ssDNAEscherichia Coli (E. Coli) O111:B4 and K12 strainsLipopolysaccharide (LPS) and Whole cellIdentify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0033 187591122008In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexesL10FATCCGTCACACCTGCTCTGGTACGAATCACAGGGGATGCTGGAAGCTTGGCTCTTGGTGTTGGCTCCCGTAT725'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'ssDNAEscherichia Coli (E. Coli) O111:B4 and K12 strainsLipopolysaccharide (LPS) and Whole cellIdentify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0034 187591122008In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexesL1RATACGGGAGCCAACACCACCCGATTGCTCCTATCTTTGTTACTTCATAGCGACGAGAGCAGGGGTGACGGAT725'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'ssDNAEscherichia Coli (E. Coli) O111:B4 and K12 strainsLipopolysaccharide (LPS) and Whole cellIdentify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0035 187591122008In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexesL3RATACGGGAGCCAACACCATTCAGCACTGTCACTGCTTTGGTTTCAGTCTTCGTTAGAGCAGGTGTGACGGAT725'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'ssDNAEscherichia Coli (E. Coli) O111:B4 and K12 strainsLipopolysaccharide (LPS) and Whole cellIdentify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0036 187591122008In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexesL4RATACGGGAGCCAACACCATCTGACGACTTTGGGCTGATCGAGCTATTGTCACCGAGAGCAGGTGTGACGGAT725'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'ssDNAEscherichia Coli (E. Coli) O111:B4 and K12 strainsLipopolysaccharide (LPS) and Whole cellIdentify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0037 187591122008In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexesL6RATACGGGAGCCAACACCAATAACATAAAGTATCGATTTGTGGTCTATTTCGTTAGAGCAGGTGTGACGGAT715'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'ssDNAEscherichia Coli (E. Coli) O111:B4 and K12 strainsLipopolysaccharide (LPS) and Whole cellIdentify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0038 187591122008In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexesL7RATACGGGAGCCAACACCATCCCTGCTAACAACTCTTCCAGGCAGAGCATTCGACAGAGCAGGTGTGACGGAT725'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'ssDNAEscherichia Coli (E. Coli) O111:B4 and K12 strainsLipopolysaccharide (LPS) and Whole cellIdentify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0039 187591122008In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexesL8RATACGGGAGCCAACACCATCATGGACCCCTGTCCTAGATTTACCCCTCGGCTTAAGAGCAGGTGTGACGGAT725'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'ssDNAEscherichia Coli (E. Coli) O111:B4 and K12 strainsLipopolysaccharide (LPS) and Whole cellIdentify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0040 187591122008In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexesL9RATACGGGAGCCAACACCACATAACTTCCTTCTTAGTCATGCTGAGCCGGCCAGTAGAGCAGGTGTGACGGAT725'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'ssDNAEscherichia Coli (E. Coli) O111:B4 and K12 strainsLipopolysaccharide (LPS) and Whole cellIdentify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0041 187591122008In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexesL10RATACGGGAGCCAACACCAAGAGCCAAGCTTCCAGCATCCCCTGTGATTCGTACCAGAGCAGGTGTGACGGAT725'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'ssDNAEscherichia Coli (E. Coli) O111:B4 and K12 strainsLipopolysaccharide (LPS) and Whole cellIdentify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity.Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0054 186712602009Preliminary development of DNA aptamer-Fc conjugate opsoninsα-PDGA 2FCATCCGTCACACCTGCTCTG-GTTCGCCCCGGTCAAGGAGA-GTGGTGTTGGCTCCCGTATC605'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3'ssDNABacillus Anthracis (BA)Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsuleIdentify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins.Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-Amidation (NH₂) and 5'-BiotinylatedCell viability ranged from 90% to 95% in all experiments.N/ABest CandidateN/AN/A
ABdb_0055 186712602009Preliminary development of DNA aptamer-Fc conjugate opsoninsα-PDGA 5RGATACGGGAGCCAACACCAC-TAACTTGTTGCTGATCTTAT-CAGAGCAGGTGTGACGGATG605'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3'ssDNABacillus Anthracis (BA)Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsuleIdentify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins.Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-Amidation (NH₂) and 5'-BiotinylatedCell viability ranged from 90% to 95% in all experiments.N/ABest CandidateN/AN/A
ABdb_0056 186712602009Preliminary development of DNA aptamer-Fc conjugate opsoninsα-PDGA 2RGATACGGGAGCCAACACCAC-TCTCCTTGACCGGGGCGAAC-CAGAGCAGGTGTGACGGATG605'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3'ssDNABacillus Anthracis (BA)Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsuleIdentify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins.N/A5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-Amidation (NH₂) and 5'-BiotinylatedCell viability ranged from 90% to 95% in all experiments.N/AN/AN/AN/A
ABdb_0057 186712602009Preliminary development of DNA aptamer-Fc conjugate opsoninsα-PDGA 5FCATCCGTCACACCTGCTCTG-GATAAGATCAGCAACAAGTTA-GTGGTGTTGGCTCCCGTATC615'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3'ssDNABacillus Anthracis (BA)Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsuleIdentify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins.N/A5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-Amidation (NH₂) and 5'-BiotinylatedCell viability ranged from 90% to 95% in all experiments.N/AN/AN/AN/A
ABdb_1061 304773312018Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentratesSE40TACGACTCACTATAGGGATCC-ACCTATGGCAGATTGAGCCCAAGGGCTGTGCAGC-GAATTCCCTTTAGTGAGGGTT765'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3'ssDNAStaphylococcus Epidermidis (ATCC 49134)Whole cellIdentify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates.N/A1Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ADetectionWhole Cell RIDA5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_1062 304773312018Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentratesSE42TACGACTCACTATAGGGATCC-CCCCGAGTGAAGAGCAGGACAGCGGGACAGCGTC-GAATTCCCTTTAGTGAGGGTT765'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3'ssDNAStaphylococcus Epidermidis (ATCC 49134)Whole cellIdentify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates.N/A1Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ADetectionWhole Cell RIDA5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_1063 304773312018Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentratesSE43TACGACTCACTATAGGGATCC-GTGACTGTACGGGCTCAGTCGTTACTTGAGAGTT-GAATTCCCTTTAGTGAGGGTT765'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3'ssDNAStaphylococcus Epidermidis (ATCC 49134)Whole cellIdentify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates.SE43 bound to bacteria was four times higher compared with scrambled control and background controls, and twofold higher in PBS.1Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ADetectionWhole Cell RIDA5'-BiotinylatedN/AN/ABest CandidateN/AN/A
ABdb_1064 304773312018Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentratesSE48TACGACTCACTATAGGGATCC-AATGGCACAGCGCCTGGAACGTACTCTGTACCTG-GAATTCCCTTTAGTGAGGGTT765'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3'ssDNAStaphylococcus Epidermidis (ATCC 49134)Whole cellIdentify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates.N/A1Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ADetectionWhole Cell RIDA5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_1065 304773312018Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentratesSE52TACGACTCACTATAGGGATCC-TTCGCATCCGGCACGATGGCTAGGACACCCCGAT-GAATTCCCTTTAGTGAGGGTT765'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3'ssDNAStaphylococcus Epidermidis (ATCC 49134)Whole cellIdentify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates.N/A1Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ADetectionWhole Cell RIDA5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_1951 104519131999In vitro selection of DNA aptamers to anthrax spores with electrochemiluminescence detectionAptamer poolN/AN/AN/AssDNABacillus Anthracis (BA)Anthrax sporesDevelop an aptamer–magnetic bead-electrochemiluminescence (AM-ECL) sandwich assay for detecting anthrax spores.Display broad dynamic range equivalent to 10– 6×10(6) anthrax spores.4ECL-based and Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ADetectionSELEX5'-BiotinylatedN/AN/AN/AN/AN/A