Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 28
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0552 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12 | UGUAAUUCUGCCAUUCUUUUUGGGGCGGAAUACAGGAUGU | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | fmA12-functionalized AgNPs resulted in specific S. aureus antimicrobial activity with only a 1.6 ± 1.0% survival of 12598 cells and 51.9 ± 2.0% survival of 10832 cells. | 8 | Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI) | 95 nM (by SPR) and 67.1 ± 6.1 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | 76% fmA12 survives in 10% mouse serum at 37°C over 24 h, and in 50% serum, 85.0% fmA12 survives after 5 h. | N/A | ~52 h for fmA12. | N/A |
| ABdb_0553 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmF07 | AUACGCUGCUCACUAAAGUCGGGAGUACUCCAAUGUUUUC | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 38.9 ± 4.1 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0554 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmE09 | AUCUAGCAAGCACUUGCAAACAUUCGAUAACGGGGAUUC | 39 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 418 ± 112 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0555 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmG12 | UGCCAAUGUAACUCAACACUCUUCAUUGAGCUGUCGGGCA | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI) | 475 nM (by SPR) and 220 ± 24 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0556 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12Δ3 | N/A | N/A | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 69.7 ± 3.5 nM | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0557 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12Δ6 | N/A | N/A | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 63.1 ± 7.3 μM | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0558 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12Δ9 | N/A | N/A | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 69.1 ± 16.7 nM | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0633 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | MA1 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACTGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | Sandwich ELISA based on MA2 and MA1 display a linear range of 8 × 10(4) to 128 × 10(4) CFU with the detection limit of 1 × 10(4) CFU. | 10 | Bio-Layer Interferometry (BLI) | 12.02 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0634 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | MA2 | GGGAGCTCAGAATAAACGCTCAA-TATCCCTATTCCGCTCCATGTTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | Sandwich ELISA based on MA2 and MA1 display a linear range of 8 × 10(4) to 128 × 10(4) CFU with the detection limit of 1 × 10(4) CFU. | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0635 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | E6-15 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACCGGTGGCTCTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0636 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P9-3 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACCGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0637 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P9-4 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACTGGTGGCTCTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0638 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | E7-12 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAGTAGACTGGTGGCTCTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0639 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P9-5 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGTCTGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0640 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | E9-16 | GGGAGCTCAGAATAAACGCTCAA-CGGGCTAGTCAATAGACTGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0641 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P6-5 | GGGAGCTCAGAATAAACGCTCAA-TATCCCTATTCCGCTCCATGCTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0642 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P10-4 | GGGAGCTCAGAATAAACGCTCAA-TACCCCTATTCCGCTCCATGTTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0643 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P10-8 | GGGAGCTCAGAATAAACGCTCAA-CATCCCTATTCCGCTCCATGTTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1188 | 28887814 | 2018 | Construction and application of an electrochemical biosensor based on an endotoxin aptamer | EAQ2 | ATGAGAGCGTCGGTGTGGTATGCTCACCCCCTGCGGCGCCGTTACGCGGTCCTTGTGTAGGAGGGTGCGGAAGTA | 75 | N/A | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L2880) | Lipopolysaccharide (LPS) | An electrochemical aptasensor was developed using an aptamer assembled on a gold electrode surface using 3-mercaptopropionic acid (MPA) as an intermediate linker to detect endotoxin. | N/A | N/A | Bio-Layer Interferometry (BLI) | 32.5 nM | Biosensor | N/A | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1189 | 28887814 | 2018 | Construction and application of an electrochemical biosensor based on an endotoxin aptamer | EAQ3 | ATGAGAGCGTCGGTGTGGTATCGCCGCGCTCGCCGATCGTTCCTCCCCCCCCGTCTGTAGGAGGGTGCGGAAGTA | 75 | N/A | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L2880) | Lipopolysaccharide (LPS) | An electrochemical aptasensor was developed using an aptamer assembled on a gold electrode surface using 3-mercaptopropionic acid (MPA) as an intermediate linker to detect endotoxin. | Showed a low detection limit of 0.001 EU/mL and a linear range of 0.001–1 EU/mL. | N/A | Bio-Layer Interferometry (BLI) | 22.9 nM | Biosensor | N/A | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | The biosensor maintained a steady EIS response value after 1 week of storage in the PBS (10 mM, pH 7.4) at 4°C, and the response value still occupied 90%. | Best Candidate | N/A | N/A |
| ABdb_1344 | 31033156 | 2019 | Inkjet Printed Nanopatterned Aptamer-Based Sensors for Improved Optical Detection of Foodborne Pathogens | a-aptamer | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGATCCATGCTGAGGTGGTCATAGCTGATCCTACC | 68 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed an inkjet-printed nanopatterned aptamer-based sensor for optical detection of E. coli O157:H7. | Display a LOD of 25 CFU/mL in pure culture and 233 CFU/mL in ground beef. | N/A | Bio-Layer Interferometry (BLI) | N/A | Biosensor | N/A | 5'-Carboxy and 5'-Biotin-TEG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1404 | 32685985 | 2020 | Electrochemical aptasensor using boron-carbon nanorods decorated by nickel nanoparticles for detection of E. coli O157:H7 | Anti-E. coli O157:H7 aptamer | ATCCAGAGTGACGCAGCA-GGGTGGCGAGACTGGGCGGGTGTCGGGAAGTGAACCGGTGGCGTG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed a label-free impedimetric aptasensor for the detection of E. coli O157:H7 employing boron-carbon nanorods decorated by nickel nanoparticles (BC-Ni) nanostructured platform. | Detect E. coli O157:H7 selectively with a detection limit of 10 cfu and a dynamic detection range of 10(0) to 10(5) cfu in water, juice, and faecal samples. | 15 | Bio-Layer Interferometry (BLI) | 69.73 nM | Biosensor | Microtiter Plate-based Cell SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1470 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx1.1) | ATCCAGAGTGACGCAGCA-GTAGTTTGTTGGTTATTACGGCGGGTTGCGATGGGTGCGAATCGG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx1 (Stx1.1) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | LOD of 44.5 pg/mL for stx1 with minimal cross-reactivity and a dynamic response range from 50 pg/mL to 100 ng/mL. | 7 | Bio-Layer Interferometry (BLI) | 8.27 nM (of peptide) and 47.2 pM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1471 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx1.3) | ATCCAGAGTGACGCAGCA-GGATAGGACGTCAAATTAGGGCCCGGTACAACGAAAGCCCACAAC-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx1 (Stx1.2) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | N/A | 7 | Bio-Layer Interferometry (BLI) | 31.0 nM (of peptide) and 30.3 μΜ (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1472 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx2.1) | ATCCAGAGTGACGCAGCA-GGGGGCAGGTTCATGGCTTGGGTGCGGTGGGCATGATTCGTGGTG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx2 (Stx2.1) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | N/A | 7 | Bio-Layer Interferometry (BLI) | 45.2 nM (of peptide) and 83.8 nM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1473 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx2.2) | ATCCAGAGTGACGCAGCA-TGTATCTCTTACTTAAGCCTTTGGTTCGGTAACAGCCTGGCATGC-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx2 (Stx2.2) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | N/A | 7 | Bio-Layer Interferometry (BLI) | 110 nM (of peptide) and 25.2 μM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1474 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx2.3) | ATCCAGAGTGACGCAGCA-GGAAAGGACGTCAAATTAGGGGCCGGGACAACGAAAGCCCACAAC-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx2 (Stx2.3) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | LOD of 41.3 pg/mL for stx2 with minimal cross-reactivity and a dynamic response range from 50 pg/mL to 100 ng/mL. | 7 | Bio-Layer Interferometry (BLI) | 4.6 nM (of peptide) and 28.6 pM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2112 | 28728009 | 2017 | Bridged Rebar Graphene functionalized aptasensor for pathogenic E. coli O78:K80:H11 detection | Anti-E.coli aptamer | N/A | N/A | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O78:K80:H11 (MTCC 726) | Whole cell | A novel fabrication method of functionalised Bridged Rebar Graphene (BRG) onto EIS-based nanostructured aptasensor for label-free detection of E. coli O78:K80:H11. | LOD ~ 10(1) cfu/mL with a dynamic response range from 10(1) to 10(6) cfu/mL. | 12 | Bio-Layer Interferometry (BLI) | 14 nM | Biosensor | Phenylboronic acid (PBA) mediated SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |