Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 273
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0009 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F1-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-ACUGUCCUCCCUUCAGAGAGCGCGGGACCCUUAACUUGGGGCCCACGAACAGCUUCAGUUCCGUCUCGGCGU-CAUAUGUGCGUCUACAUGGAUCCUCA | 140 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | Addition of aptamer F1-1 in a 1000-fold excess over the colicin E3 CRD completely restored protein synthesis. | 12 | Nitrocellulose Filter Binding Assay | 2 ± 11 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0010 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F2-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-UCCCUGGCCCAAGAUCCUAAUAAAGUUUUUUCGGACCGGAGCGAAACCACUAUCCUCUUAAGCAAUCUGU-CAUAUGUGCGUCUACAUGGAUCCUCA | 138 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | Addition of aptamer F2-1 in a 1000-fold excess over the colicin E3 CRD completely restored protein synthesis. | 12 | Nitrocellulose Filter Binding Assay | 14 ± 2 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0011 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F3-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GUACAACACAUCAUUACGGCUGCUAUUGGCUCCAAGCGUCUUUCUCCCUGGUCAAUAGUCCAGCCACCACG-CAUAUGUGCGUCUACAUGGAUCCUCA | 139 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | N/A | 12 | Nitrocellulose Filter Binding Assay | 4 ± 15 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0012 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F4-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GACAUCUGUAAGUAAGAUUCUAUCUGCAAAGCGGUUAGGAGGGCUCGGACUCUGAUUGCCUCCCCGCACC-CAUAUGUGCGUCUACAUGGAUCCUCA | 138 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | N/A | 12 | Nitrocellulose Filter Binding Assay | 7 ± 1 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0013 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F5-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GUCAGCUGCUCGCGGGAUCGAUCCAUUCGGUGGCCAUGCUCCGGAAGAGGCUUCGCAAGACUCAGG-CAUAUGUGCGUCUACAUGGAUCCUCA | 134 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | N/A | 12 | Nitrocellulose Filter Binding Assay | 10 ± 1 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0014 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F4-2 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GACAUCUGUAAGUAAGAUUCUAUCUGCAAAGCGGUUAGGGGGGCUCGGACUCUGAUUGCCUCCCCGCACC-CAUAUGUGCGUCUACAUGGAUCCUCA | 138 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | N/A | 12 | Nitrocellulose Filter Binding Assay | 294 ± 170 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0015 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.4 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-UCACUGUUAUCCGAUAGCAGCGCGGGAUGA-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | 2.0 μg of RNA aptamer S-PS8.4 effected ca. 71% inhibition of cell invasion by pil+ S. enterica serovar Typhi A21-6 but only ca. 19% inhibition in the case of the pilS::Kmr mutant. | 8 | Nitrocellulose Filter Binding Assay | 8.56 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0016 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.3 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-AUUACCUAGAGCGGGAUAAAGUAUAGGUU-GGGUCAAUGCGUCAUA | 87 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0017 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.2 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-CAUCGAGGAGGCGGGAUAUUCGAUGAGUU-GGGUCAAUGCGUCAUA | 87 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0018 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.5 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-GAGUACGAGCGGGAUAGUAAUCGGGUGAU-GGGUCAAUGCGUCAUA | 87 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0019 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.6 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-GAAGGGGUCCGGCUCGGGUGAGGGUCGGGU-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0020 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.9 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-AGCUAGCGGGGGGGCUCGACGGUGGUGGGUU-GGGUCAAUGCGUCAUA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0021 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.7 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-UAGCGGGAGCUUGGACCUGGUGGUCGCGGC-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0022 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.1 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-UUGGGAUCAGCUCGGCGCUGGAGGAGGGGC-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0023 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.8 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-AACUGUACAUGGGCGCAACAGGGAGUUAGC-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0026 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L1F | ATCCGTCACCCCTGCTCTCGTCGCTATGAAGTAACAAAGATAGGAGCAATCGGGTGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0027 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L3F | ATCCGTCACACCTGCTCTAACGAAGACTGAAACCAAAGCAGTGACAGTGCTGAATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0028 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L4F | ATCCGTCACACCTGCTCTCGGTGACAATAGCTCGATCAGCCCAAAGTCGTCAGATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0029 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L6F | ATCCGTCACACCTGCTCTAACGAAATAGACCACAAATCGATACTTTATGTTATTGGTGTTGGCTCCCGTAT | 71 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0030 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L7F | ATCCGTCACACCTGCTCTGTCGAATGCTCTGCCTGGAAGAGTTGTTAGCAGGGATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0031 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L8F | ATCCGTCACACCTGCTCTTAAGCCGAGGGGTAAATCTAGGACAGGGGTCCATGATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0032 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L9F | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0033 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L10F | ATCCGTCACACCTGCTCTGGTACGAATCACAGGGGATGCTGGAAGCTTGGCTCTTGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0034 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L1R | ATACGGGAGCCAACACCACCCGATTGCTCCTATCTTTGTTACTTCATAGCGACGAGAGCAGGGGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0035 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L3R | ATACGGGAGCCAACACCATTCAGCACTGTCACTGCTTTGGTTTCAGTCTTCGTTAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0036 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L4R | ATACGGGAGCCAACACCATCTGACGACTTTGGGCTGATCGAGCTATTGTCACCGAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0037 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L6R | ATACGGGAGCCAACACCAATAACATAAAGTATCGATTTGTGGTCTATTTCGTTAGAGCAGGTGTGACGGAT | 71 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0038 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L7R | ATACGGGAGCCAACACCATCCCTGCTAACAACTCTTCCAGGCAGAGCATTCGACAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0039 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L8R | ATACGGGAGCCAACACCATCATGGACCCCTGTCCTAGATTTACCCCTCGGCTTAAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0040 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L9R | ATACGGGAGCCAACACCACATAACTTCCTTCTTAGTCATGCTGAGCCGGCCAGTAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0041 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L10R | ATACGGGAGCCAACACCAAGAGCCAAGCTTCCAGCATCCCCTGTGATTCGTACCAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0054 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 2F | CATCCGTCACACCTGCTCTG-GTTCGCCCCGGTCAAGGAGA-GTGGTGTTGGCTCCCGTATC | 60 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | Best Candidate | N/A | N/A |
| ABdb_0055 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 5R | GATACGGGAGCCAACACCAC-TAACTTGTTGCTGATCTTAT-CAGAGCAGGTGTGACGGATG | 60 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | Best Candidate | N/A | N/A |
| ABdb_0056 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 2R | GATACGGGAGCCAACACCAC-TCTCCTTGACCGGGGCGAAC-CAGAGCAGGTGTGACGGATG | 60 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | N/A | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | N/A | N/A | N/A |
| ABdb_0057 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 5F | CATCCGTCACACCTGCTCTG-GATAAGATCAGCAACAAGTTA-GTGGTGTTGGCTCCCGTATC | 61 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | N/A | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | N/A | N/A | N/A |
| ABdb_0059 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 19 | TAGGGAATTCGTCACGGATCC-GGCGTCCACTCCCAGCCGCTCACTAGTTTCTGCGTGGGTGA-CTGCAGGTCGACGCATGCGCCG | 84 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | Survival rate of mice with LPS-induced sepsis increased from 10% to 75% after treatment. | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0060 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 18 | TAGGGAATTCGTCACGGATCC-GGCGTCCACTCCCAGCCGGTCACTAGTTTCTGCGTGGGTGA-CTGCAGGTCGACGCATGCGCCG | 84 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0061 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 31 | TAGGGAATTCGTCACGGATCC-GGAGAATAACGACAAAAGGTAAACTACAGGCCCGGAGC-CTGCAGGTCGACGCATGCGCCG | 81 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0062 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 14 | TAGGGAATTCGTCACGGATCC-AAAAGTCCTTGCAAGATAGACGCAGCCAGCCGGGTAGTC-CTGCAGGTCGACGCATGCGCCG | 82 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0063 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 25 | TAGGGAATTCGTCACGGATCC-CTTGGCGTTACTTACCTGTACGTCGTAGAG-CTGCAGGTCGACGCATGCGCCG | 73 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0064 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 43 | TAGGGAATTCGTCACGGATCC-TGAACGACGTCGCATTAGCGAGTAGGTTTACGAAGTAAGA-CTGCAGGTCGACGCATGCGCCG | 83 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0322 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S 1 | ATAGGAGTCACGACGACCAGAA-CGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGGCAGGG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Identify an aptamer targeted against Shigella dysenteriae and develop a sandwich-type fluorescent bioassay for quantification. | Obtained linear range between 10(2)-10(7) cfu/mL of S. dysenteriae, and the limit of detection was 50 cfu/mL | 8 | Fluorescence Binding Assay | 23.47 ± 2.48 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled and Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0323 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S12 | ATAGGAGTCACGACGACCAGAA-CCTGGCGGGTCCCGGGGTAAACGGCACAAACGATAAAGAA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0324 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S2 | ATAGGAGTCACGACGACCAGAA-AAGATGACACTTGGCAGCCGCCTCGAGTGTCCTACACGCA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0325 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S8 | ATAGGAGTCACGACGACCAGAA-GCCAGATGAGGCCGGCAGGGCCCAAGTGTTGCTCGGGCTA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0326 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S21 | ATAGGAGTCACGACGACCAGAA-TGCACGGGACAAGAGTACACGCCGATTGCCAGGCACAGTG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | 75.49 ± 3.74 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0327 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S10 | ATAGGAGTCACGACGACCAGAA-GGGGAAGCCGATCAGGCCAATCATTGAGGGTGAACTAGCT-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0328 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S19 | ATAGGAGTCACGACGACCAGAA-TTATCGGCTGGCAAAACTGCGGCTGGAGCTCACAACTAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0329 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S13 | ATAGGAGTCACGACGACCAGAA-TCAGCGAGGGCCAATTAGAAGGGTACTCATGTCTGTGGAC-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0330 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S24 | ATAGGAGTCACGACGACCAGAA-CCAGGCGGAATGTGTCTTCGTTTTGCGAGTGTTAAGGGCG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0356 | 25185503 | 2014 | Selection of peptidoglycan-specific aptamers for bacterial cells identification | Antibac1 | TCGCGCGAGTCGTCTG-GGGACAGGGAGTGCGCTGCTCCCC-CCGCATCGTCCTCCC | 55 | 5'-TCGCGCGAGTCGTCTG-N24-CCGCATCGTCCTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) and Escherichia Coli (E. Coli) TOP10 | Peptidoglycan | Identify aptamers that bind to the peptidoglycan of bacterial cells. | High binding affinity for S. aureus, as the radioactivity of Antibac1 was 28 times higher than the negative control. | 5 | Saturation Binding Assay | 0.415 + 0.047 μM | Detection | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0357 | 25185503 | 2014 | Selection of peptidoglycan-specific aptamers for bacterial cells identification | Antibac2 | TCGCGCGAGTCGTCTG-GGGGACTAGAGGACTTGTGCGGCC-CCGCATCGTCCTCCC | 55 | 5'-TCGCGCGAGTCGTCTG-N24-CCGCATCGTCCTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) and Escherichia Coli (E. Coli) TOP10 | Peptidoglycan | Identify aptamers that bind to the peptidoglycan of bacterial cells. | High binding affinity for S. aureus, as the radioactivity of Antibac2 was 22 times higher than the negative control. | 5 | Saturation Binding Assay | 1.261 + 0.280 μM | Detection | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0409 | 24763818 | 2014 | Rapid fluorescent detection of Escherichia coli K88 based on DNA aptamer library as direct and specific reporter combined with immuno-magnetic separation | Apt B12 | TGGGAGCTCAGAATAAACGCTCAA-GGCACACAGGACTATACAGTGTTGCAGTGTTGCTG-TTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | DNA aptamer library for rapid detection of ETEC K88 combined with immuno-magnetic separation (IMS). | Exhibit detection limit of 1.1 × 10(3) CFU/ml in pure culture and 2.2 × 10(3) CFU/g in artificially contaminated faecal sample with aptamer library. | 13 | Fluorescence Binding Assay | 15 ± 4 nM | Diagnostic | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0410 | 24763818 | 2014 | Rapid fluorescent detection of Escherichia coli K88 based on DNA aptamer library as direct and specific reporter combined with immuno-magnetic separation | Apt H11 | TGGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | DNA aptamer library for rapid detection of ETEC K88 combined with immuno-magnetic separation (IMS). | Exhibit detection limit of 1.1 × 10(3) CFU/ml in pure culture and 2.2 × 10(3) CFU/g in artificially contaminated faecal sample with aptamer library. | 13 | Fluorescence Binding Assay | 66 ± 7 nM | Diagnostic | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0411 | 24763818 | 2014 | Rapid fluorescent detection of Escherichia coli K88 based on DNA aptamer library as direct and specific reporter combined with immuno-magnetic separation | Apt C09 | TGGGAGCTCAGAATAAACGCTCAA-TGGCCGTGTGGATAGAGGCGTGTTGTATGGGTGTG-TTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | DNA aptamer library for rapid detection of ETEC K88 combined with immuno-magnetic separation (IMS). | Exhibit detection limit of 1.1 × 10(3) CFU/ml in pure culture and 2.2 × 10(3) CFU/g in artificially contaminated faecal sample with aptamer library. | 13 | Fluorescence Binding Assay | 52 ± 8 nM | Diagnostic | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0412 | 24763818 | 2014 | Rapid fluorescent detection of Escherichia coli K88 based on DNA aptamer library as direct and specific reporter combined with immuno-magnetic separation | Apt H12 | TGGGAGCTCAGAATAAACGCTCAA-GGGGAGGCAGTGTGTTGTGCCGTGTGTATGCTTGG-TTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | DNA aptamer library for rapid detection of ETEC K88 combined with immuno-magnetic separation (IMS). | Exhibit detection limit of 1.1 × 10(3) CFU/ml in pure culture and 2.2 × 10(3) CFU/g in artificially contaminated faecal sample with aptamer library. | 13 | Fluorescence Binding Assay | 106 ± 12 nM | Diagnostic | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0458 | 25188392 | 2014 | Gold nanoparticle-based enzyme-linked antibody-aptamer sandwich assay for detection of Salmonella Typhimurium | STM-binding aptamer | ATCCGTCACACCTGCTCTGGAGCAATATGGTGGAGAAACGTGGTGTTGGCTCCCGTAT | 58 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (CMCC 50115) | Whole cell | Develop a gold nanoparticle-based enzyme-linked antibody-aptamer sandwich (nano-ELAAS) method for quantitative detection of STM. | Quantitative detection range: 1 × 10³ to 1 × 10⁸ CFU/mL and LOD: 1 × 10³ CFU/mL, and a selectivity of >10-fold for STM in samples containing other bacteria at higher concentration, with an assay time of less than 3 h. | N/A | LPS-Aptamer Plate Binding Assay | 19.59 ± 0.35 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-FITC Labeled and 5'-Biotinylated | N/A | MMP-aptamers and nanoprobes were stored at 4°C for 2 weeks, no obvious change of the S/B was observed. | N/A | N/A | N/A |
| ABdb_0574 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/8 | ATACCAGCTTATTCAATT-AGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | PA#2/8 competes with IgG or IgG-Fc for binding to Protein A. | 11 | Bead-based Binding Assay | 1.06 ±0.2 μM | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0575 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#4/22 | ATACCAGCTTATTCAATT-GCAGTACTGATGAGTGTAGCCGTATGATTATCGTTTGTGG-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0576 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#4/34 | ATACCAGCTTATTCAATT-CCCCAACGAGTCGATATGTAGCCCACACTCTGATTCGTCC-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0577 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/11 | ATACCAGCTTATTCAATT-GGAGACGACAAACTATTACGTACTACGGCATGCACTTGGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0578 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/3 | ATACCAGCTTATTCAATT-CGACAAGTGGGCATTACGATTCTAGCCCTGATTATGTTCC-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0579 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/6 | ATACCAGCTTATTCAATT-ACCGATCACTAGCCGACTAATTGGTTTCCGATCGCAGTCC-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0580 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#14/82 | ATACCAGCTTATTCAATT-CCACAACCGAACTCGTAAGACGTATGTAGCCGCCAACTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0581 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#6/52 | ATACCAGCTTATTCAATT-ACGCATTGGAGCCCGAAACTGATTCATTGAGCCTACCTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0582 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/14 | ATACCAGCTTATTCAATT-ACGACCGTAGACGACTTACACTGATGTTGCGCATTTCTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0583 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#4/31 | ATACCAGCTTATTCAATT-CGATGACGACTGTAGCCGCAATACGCCCCTGTTACGTTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0584 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#6/41 | ATACCAGCTTATTCAATT-GGACGCCGACTAACTTTACGTGGTTCTCCTACCGCCTAACC-ACAATCGTAATCAGTTAG | 77 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0585 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#6/43 | ATACCAGCTTATTCAATT-ACGAAATGTAGCCGATCCTGATTACTCTCTGTCAGCTTGG-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0696 | 25533762 | 2015 | Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m | SA20 | GCAATGGTACGGTACTTCC-GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | 99mTc-labelled aptamers for bacterial infection identification. | EC50 value of 99mTc labelled aptamer was 70.86 nM and displayed a target/non-target ratio of 4.0±0.5. | N/A | Radiolabeled Binding assay | N/A | Diagnostic | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (32P-labeled) | N/A | Radiolabeled aptamers with 99mTc were stable in 0.9% saline solution, in plasma, and in the presence of excess cysteine (50-, 500-, and 5000-fold), even for long period of 24hr. | N/A | N/A | N/A |
| ABdb_0697 | 25533762 | 2015 | Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m | SA23 | GCAATGGTACGGTACTTCC-GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | 99mTc-labelled aptamers for bacterial infection identification. | EC50 value of 99mTc labelled aptamer was 61.50 nM and displayed a target/non-target ratio of 4.0±0.5. | N/A | Radiolabeled Binding assay | N/A | Diagnostic | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (32P-labeled) | N/A | Radiolabeled aptamers with 99mTc were stable in 0.9% saline solution, in plasma, and in the presence of excess cysteine (50-, 500-, and 5000-fold), even for long period of 24hr. | N/A | N/A | N/A |
| ABdb_0698 | 25533762 | 2015 | Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m | SA34 | GCAATGGTACGGTACTTCC-CACAGTCACTCAGACGGCCGCTATTGTTGCCAGATTGCCTTTGGC-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | 99mTc-labelled aptamers for bacterial infection identification. | EC50 value of 99mTc labelled aptamer was 72.42 nM and displayed a target/non-target ratio of 4.0±0.5. | N/A | Radiolabeled Binding assay | N/A | Diagnostic | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (32P-labeled) | N/A | Radiolabeled aptamers with 99mTc were stable in 0.9% saline solution, in plasma, and in the presence of excess cysteine (50-, 500-, and 5000-fold), even for long period of 24hr. | N/A | N/A | N/A |
| ABdb_0935 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.1A | GCGC(U^y)CGCGCGGCG(U^y)GC-ACAACAAA(U^y)G(U^y)GACCA(U^y)GCGA(U^y)(U^y)CCCCA(U^y)A(U^y)CCAGGCACA-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0936 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.2A | GCGC(U^y)CGCGCGGCG(U^y)GC-GA(U^y)GCG(U^y)G(U^y)GG(U^y)G(U^y)GGAG(U^y)(U^y)G(U^y)G(U^y)GAG(U^y)GG(U^y)C(U^y)GCG(U^y)(U^y)G(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0937 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.5B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)(U^y)CA(U^y)GCCC(U^y)G(U^y)G(U^y)C(U^y)(U^y)GC(U^y)C(U^y)(U^y)G(U^y)GAG(U^y)(U^y)G(U^y)(U^y)G(U^y)G(U^y)CA-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0938 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.8A | GCGC(U^y)CGCGCGGCG(U^y)GC-G(U^y)G(U^y)G(U^y)A(U^y)GCG(U^y)(U^y)CA(U^y)G(U^y)GG(U^y)GAGG(U^y)C(U^y)(U^y)GCG(U^y)C(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0939 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.10A | GCGC(U^y)CGCGCGGCG(U^y)GC-GAG(U^y)G(U^y)G(U^y)G(U^y)GGG(U^y)CCGAG(U^y)GGG(U^y)GG(U^y)CAGGG(U^y)(U^y)(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%. | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0940 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.14B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)C(U^y)G(U^y)G(U^y)GCGG(U^y)G(U^y)(U^y)A(U^y)GCGGG(U^y)(U^y)GGG(U^y)(U^y)G(U^y)(U^y)(U^y)G(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%. | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0941 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.16B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)(U^y)(U^y)GCG(U^y)CCGGG(U^y)(U^y)(U^y)A(U^y)GCGGG(U^y)(U^y)G(U^y)C(U^y)CG(U^y)G(U^y)C(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0942 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.17B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)C(U^y)(U^y)G(U^y)(U^y)GGG(U^y)CGACGG(U^y)C(U^y)G(U^y)(U^y)CA(U^y)G(U^y)GGG(U^y)G(U^y)(U^y)G(U^y)CCC-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0943 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.18B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)(U^y)G(U^y)G(U^y)(U^y)CACG(U^y)CA(U^y)(U^y)(U^y)CGCAC(U^y)CC(U^y)C(U^y)CAGC(U^y)ACG(U^y)(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%. | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0944 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.24A | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)G(U^y)G(U^y)(U^y)(U^y)G(U^y)GG(U^y)ACGAGCG(U^y)G(U^y)G(U^y)GGA(U^y)GG(U^y)CCG(U^y)G(U^y)CA-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0945 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.28A | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)CC(U^y)CGCG(U^y)(U^y)(U^y)GGA(U^y)(U^y)CA(U^y)G(U^y)(U^y)GG(U^y)(U^y)(U^y)G(U^y)CGG(U^y)G(U^y)A(U^y)(U^y)G(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%. | 12 | Saturation Binding Assay | 27.4 ± 18.7 nM | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) and Radiolabelled ([γ-32P]-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0946 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.30A | GCGC(U^y)CGCGCGGCG(U^y)GC-ACAGAAAG(U^y)G(U^y)GGCCA(U^y)G(U^y)G(U^y)(U^y)G(U^y)G(U^y)CCC(U^y)GGCAGG(U^y)(U^y)AG(U^y)(U^y)(U^y)A-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 81 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0975 | 28715874 | 2017 | Detection of bacterial infection by a technetium-99m-labeled peptidoglycan aptamer | Antibac1 | TCGCGCGAGTCGTCTGGGGACAGGGAGTGCGCTGCTCCCCCCGCACGTCCTCCC | 54 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Peptidoglycan | Radiolabeled aptamers were evaluated for biodistribution studies and scintigraphic imaging in infection‐bearing mice. | Achieved a high target-to-non-target (T/NT) ratio of 4.7 ± 0.9 at 1.5 h and 4.6 ± 0.1 at 3.0 h in bacterial-infected models. | N/A | Binding Assay | 0.170 ± 0.032 μM | Imaging | N/A | 5'-Inverted Thymidine (5'-idT), 3'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (99mTc labeled) | N/A | Radiolabeling yields were superior to 90% and 99mTc‐Antibac1 was highly stable in the presence of saline, plasma, and cysteine up to 6 h. | N/A | Distribution half-life: 6.7 min and Elimination half-life: 41.3 min. | N/A |
| ABdb_1038 | 30563044 | 2018 | 2'-Fluoro-Pyrimidine-Modified RNA Aptamers Specific for Lipopolysaccharide Binding Protein (LBP) | A011 | CCAAGCUUGCAUGCCUGCAG-GGACUGUGGAUUGUUCUGGGUGCCGCUUCUCCGAAUAUCGGACUCUCGAACUCCUGGGGA-GGUACCGAGCUCGAAUUCCC | 100 | 5'-CCAAGCTTGCATGCCTGCAG-N60-GGTACCGAGCTCGAATTCCC-3' | ssRNA | Gram-negative Bacteria | Murine Lipopolysaccharide Binding Protein (mLBP) | Identify aptamers that bind to and inhibit the LPS-LBP interaction or block of LBP-mediated transfer of LPS monomers to CD14. | N/A | 8 | Nitrocellulose Filter Binding Assay | 267 ± 48 nM | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1039 | 30563044 | 2018 | 2'-Fluoro-Pyrimidine-Modified RNA Aptamers Specific for Lipopolysaccharide Binding Protein (LBP) | A036 | CCAAGCUUGCAUGCCUGCAG-GAUAUACGGUGCCGCUUCUCUAACCGGUGGUCAUGCGGUUGGACGCUCGAACAGACUA-GGUACCGAGCUCGAAUUCCC | 98 | 5'-CCAAGCTTGCATGCCTGCAG-N60-GGTACCGAGCTCGAATTCCC-3' | ssRNA | Gram-negative Bacteria | Murine Lipopolysaccharide Binding Protein (mLBP) | Identify aptamers that bind to and inhibit the LPS-LBP interaction or block of LBP-mediated transfer of LPS monomers to CD14. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1061 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE40 | TACGACTCACTATAGGGATCC-ACCTATGGCAGATTGAGCCCAAGGGCTGTGCAGC-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | N/A | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1062 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE42 | TACGACTCACTATAGGGATCC-CCCCGAGTGAAGAGCAGGACAGCGGGACAGCGTC-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | N/A | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1063 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE43 | TACGACTCACTATAGGGATCC-GTGACTGTACGGGCTCAGTCGTTACTTGAGAGTT-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | SE43 bound to bacteria was four times higher compared with scrambled control and background controls, and twofold higher in PBS. | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1064 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE48 | TACGACTCACTATAGGGATCC-AATGGCACAGCGCCTGGAACGTACTCTGTACCTG-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | N/A | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1065 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE52 | TACGACTCACTATAGGGATCC-TTCGCATCCGGCACGATGGCTAGGACACCCCGAT-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | N/A | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1220 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A16 | CCATCCACACTCCGCAAGTGGGGAGGGGAGAGACGACGATCCTGTGGGTTTTCTGCAGTGAGTCGTGTTTTCGACTTATTGCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | 28.47 nM | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1221 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A46 | CCATCCACACTCCGCAAGTATGAGGACAGTTGGAGGGCGCGCCGTGTTTTTTCTGCAGTGAGTCGTGTTTCCTCGCTCACGCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | N/A | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1222 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A1 | CCATCCACACTCCGCAAGTTTTAGGAGTAGTGGTGTGGGGACCGACTCTTTTCTGCAGTGAGTCGTGTTTTCGAGTCATCCCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | N/A | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1223 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A2 | CCATCCACACTCCGCAAGTGAGATGTGGTGTAGGCAACTCGGCATAGATTTTCTGCAGTGAGTCGTGTTTTTTGACACGGCCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | N/A | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1238 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp1 | AGTGTGCTCTTCTCAGGTCT-GTGGCCGGGGGCACTAATGCGGGCTATAAGTCTCCTTGGG-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | 35.60 ± 6.36 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1239 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp2 | AGTGTGCTCTTCTCAGGTCT-CCTATACCTGGCATCAGAGAGCTAGGGGCCACGGTTCGCA-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | 204.38 ± 97.31 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1240 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp3 | AGTGTGCTCTTCTCAGGTCT-GGTGCTGCGATGCTTTCTGGTGGTGTATGGTTGTCTTTTG-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1241 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp4 | AGTGTGCTCTTCTCAGGTCT-CGGCGCGGTTGTGGGTACCTAGGGTTGTTGTTGCTTCTCA-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | Hp4 had excellent binding to H pylori cells and almost no binding to E coli, S aureus, or V anguillarum. | N/A | Fluorescence Binding Assay | 26.48 ± 5.72 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1242 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp5 | AGTGTGCTCTTCTCAGGTCT-GGGCTGTGGGTCGGCACGTCGTCTCTTCATGGTTGTGGTG-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1243 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp6 | AGTGTGCTCTTCTCAGGTCT-TTAGGGACCCATGGGCTAACCCGGGCACAAGATTGTCTCA-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1244 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp7 | AGTGTGCTCTTCTCAGGTCT-ACACAACCTGCCGTATTGTAACCGTCGTCCCCCCGAAGCA-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1282 | 31511614 | 2019 | Detection of Gram-negative bacterial outer membrane vesicles using DNA aptamers | GN6 | ATACCAGCTTATTCAATT-GGGTGAGGGGGGGTTCACAACGTTAAAGATAGACGGGGGA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Gram-negative Bacteria (Escherichia Coli (E. Coli) DH5α, Escherichia Coli (E. Coli) K12, and Serratia Marcescens) | Whole cell | Isolated aptamers against multiple Gram-negative bacterial species and developed an aptamer-based detection tool (ELAA) towards bacterial secretory cargo released from the outer membranes of Gram-negative bacteria. | Can detect as low as 25 ng/mL of bacterial OMVs, and dissociation constants of GN6 to OMVs derived from E. coli DH5α, E. coli K12 and S. marcescens were 0.13 ± 0.01 μg/ml, 3.70 ± 0.98 μg/ml and 0.23 ± 0.16 μg/ml, respectively. | 12 | Fluorescence Binding Assay | 29.94 ± 2.49 nM (for E. coli DH5α), 59.70 ± 10.89 nM (for E. coli K12) and 38.98 ± 6.46 nM (for S. marcescens) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 5'-Biotinylated and 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1283 | 31511614 | 2019 | Detection of Gram-negative bacterial outer membrane vesicles using DNA aptamers | GN12 | ATACCAGCTTATTCAATT-CCGAGTCCAGACTCACCGCCGCCTCCTCAAGACGTGCTGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Gram-negative Bacteria (Escherichia Coli (E. Coli) DH5α, Escherichia Coli (E. Coli) K12, and Serratia Marcescens) | Whole cell | Isolated aptamers against multiple Gram-negative bacterial species and developed an aptamer-based detection tool towards bacterial secretory cargo released from the outer membranes of Gram-negative bacteria. | GN12 was 3.6 times higher in binding to 10(8) cells of Gram-negative bacteria than to Gram-positive bacteria tested. | 12 | Fluorescence Binding Assay | 20.36 ± 2.38 nM (for E. coli DH5α), 24.80 ± 3.98 nM (for E. coli K12) and 53.83 ± 17.70 nM (for S. marcescens) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1462 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA1 | CTGCGATCAAGTTACGCACCTCGCCATGTTCCCCGCCCGGCATGTGTTATGCCCCTGTG | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | C. jejuni can be detected from 1.7 × 10(1) to 1.7 × 10(6) CFU/mL. The limit of detection (LOD) is obtained as 10 CFU/mL in PBS and 13 CFU/mL in contaminated milk samples. | 12 | Fluorescence Binding Assay | 1.37 ± 0.28 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1463 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA2 | GTTGGGTGCGGCGGGAGGGTCCCATCGGAAACCAAGCTGTGCTGAGATTTTTCCGCGAT | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 1.78 ± 0.88 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1464 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA3 | CACGCAAGTTAATCAGCGTGACATCAGGTCTAGATTCCGGCTTATAGCGCCAGGTTTCC | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 2.01 ± 0.90 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1465 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA4 | GGTGGGCTCTGTTCGGGAGGGGTATTGTTAGGACCGAGAGGCTGCATTCCGCCAGCTGC | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 2.26 ± 0.91 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1466 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA5 | GCTCTGTCTTTTCAGCTTTATCCGGGTGTGGTGGGGGGGGGATTTGCTTGGTCGGTTCT | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 3.53 ± 1.38 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1720 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B46 | GGCGGCGATGAGGATGAC-GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | LOD value as low as 27 ± 11 cells. | 15 | Fluorescence Binding Assay | 616 ± 13 cells/ml | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1721 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B48 | GGCGGCGATGAGGATGAC-ACTATTTACGTTGGAACTTAAGTCCCACATGCACTGCC-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1722 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B70 | GGCGGCGATGAGGATGAC-CTATAGTGCTCAAGTGCGATGCCAAGCTGGCACGATAG-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | B70 showed about 35% higher affinity for Brucella cells than the B46 aptamer, and the SPR sensor showed an LOD of 27 ± 11 cells. | 15 | Fluorescence Binding Assay | 632 ± 132 cells/ml | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1723 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B72 | GGCGGCGATGAGGATGAC-TCCGTGACAAGTGCGATGCCATTCCGCGTGACAGTGAT-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1832 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-19 | TCCCTACGGCGCTAAC-GACATGATGGTGCCAAACAACATTCGGAAAGCCTGACCGT-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | Limit of Detection (LOD): 4.6 CFU/mL and linear trend ranging from 10 to 10(8) CFU/mL. | 10 | Fluorescence Binding Assay | 14.19 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1833 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-3 | TCCCTACGGCGCTAAC-TGGCAAATAATGCAATTGAAGAAAGCCCCCCCCTGCCCGA-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 15.61 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1834 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-29 | TCCCTACGGCGCTAAC-TGTGAAACAAGGCAAGGGAACTGACGTCATAAGGATAGCA-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 17.38 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1835 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-37 | TCCCTACGGCGCTAAC-AAGATGAAAGACGACCGGACAGTACATATAGCGCTCTCGC-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 17.96 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1836 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-31 | TCCCTACGGCGCTAAC-ACCTGCAGTAGGGAATGCGAATGATGAGACGCCTGATTGG-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 68.83 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1837 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-24 | TCCCTACGGCGCTAAC-ACAGACAGAATGAGTGAACATAGGCCAATAACGCACGTCC-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 75.24 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1856 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab1 (A00) | TGGTGCGTGCTATTCAGAGT-GAGGGACGCATGATTGGGTGACTCCGGGAGATCATGCAAG-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 14.12 ± 2.31 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1857 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab2 | TGGTGCGTGCTATTCAGAGT-GGGGTGGACCGGGGGGATCGAATAACGCATCGCGCCTAGT-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 26.26 ± 9.87 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1858 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab3 | TGGTGCGTGCTATTCAGAGT-CCTCTAGGCGGTAAGGATCGGACCTTGGTCTGATGGTGAG-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 66.51 ± 24.28 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1859 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab4 | TGGTGCGTGCTATTCAGAGT-GACGGATACGGATTCAGGGCGGAGTGCCAAGATACGGATG-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 97.98 ± 37.42 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1860 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab5 | TGGTGCGTGCTATTCAGAGT-GTTGAGGATTAGGATCGCTTTAAACGATTAGGATCCGAAT-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 142.2 ± 39.3 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1861 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | A01 | GCGCGGGCTATTCAGAGTGAGGGCCGCGTGAGCGGGCGACTCCGGGAGATCGCGCGCG | 58 | N/A | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 27.91 ± 13.34 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1862 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | A02 | GAGCGGGCGACTCCGGGAGATCGCGCGCGG | 30 | N/A | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | Exhibited a wide detection range of up to 1 × 10(7) CFU/mL and the lowest limit of detection (LOD) of 1 CFU/mL, for each bacterium. | 12 | Fluorescence Binding Assay | 6.86 ± 5.77 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1863 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | A03 | CGACTCCGGGAGATCG | 16 | N/A | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 19.33 ± 9.76 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1864 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C00 | GTCCTGAGACTCATGTCTGCTGTCAATCGCAAGGTCCATGTCCTGAGACTCATGTCTGCTGTCAATCGCAAGGTCCA | 77 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 48.12 ± 6.15 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1865 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C01 | CGCGTGTCTGCTGTCAATCGCAAGGTCCATGTCCCGCG | 38 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | Exhibited a wide detection range of up to 1 × 10(7) CFU/mL and the lowest limit of detection (LOD) of 1 CFU/mL, for each bacterium. | 12 | Fluorescence Binding Assay | 27.69 ± 5.66 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1866 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C02 | CGCGAGTCTGCTGTCAATCGCAAGGCGCG | 29 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 61.58 ± 19.805 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1867 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C03 | CGCTGTCAATCGCG | 14 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 240.2 ± 106.85 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1868 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C04 | GCGTCCATGTCGC | 13 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 259.8 ± 55.1 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1915 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg1 | TGACTGACGACGACTC-AGTGGAGTATCGCCTTGCCGACCCGGGTGTCTACGATCAGTGAGTGGTAGT-GACTGCTCGAGCTG | 81 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1916 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg2 | TGACTGACGACGACTC-TGGAGCTCGGGTATTCTCGTCAGACCCTCCTGAGTTGATTTTAGCAACCG-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1917 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg3 | TGACTGACGACGACTC-CGGCGAGTAACGACTATGTCGCACGGGTGTCTTACGAGACGGTTGGGGTC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1918 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg4 | TGACTGACGACGACTC-CTTGTCCATGGCTTGTCCACTCGGGTGTCTGGACAATGAAACCGAACTGC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1919 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg8 | TGACTGACGACGACTC-AGAACGCTTTATGCGCACGGGGGACTTCGGAGTCGTCGAGTACGGGTACC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | 183.79 ± 3.27 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1920 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg8A | TGACTGACGACGACTCAGAACGCTTTATGCGCACGGGGGACTTCGGAGTCGTCGAGT | 57 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | Achieving a limit of detection of 10 CFU/mL. | 15 | Fluorescence Binding Assay | 133.15 ± 48.56 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1922 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss1 | TGACTGACGACGACTC-CCCGCAGGGGATCCGGATGCCGCGTTGGAGGAGATATGTATTATTCCATC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | Demonstrated a linear response across a range of 10–10(8) CFU/mL for P. micra with a limit of detection of 11 CFU/mL. | 17 | Fluorescence Binding Assay | 33.84 ± 0.92 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1923 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss2 | TGACTGACGACGACTC-GGAGAACTACCGCACCAACAATTCACCGTCTGGACGTTCTGCCCTCTCCC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | N/A | 17 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1924 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss8 | TGACTGACGACGACTC-GGGAGGTCAGACTATCTTGTTCCTCCTGGAGGTCGGGAAGAGAGTTGACG-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | N/A | 17 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1925 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss9 | TGACTGACGACGACTC-GGGGGCTGTCAAAAATTACTCTTGGGCCCAGCAATGGTAATTTTCTGACC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | N/A | 17 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1942 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 11.1 | ACACTAGATCAGTCACAG-GAGCAACAGTCTCGCCTTCGTTACTGCGCGCGGGACGGGG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | CA 11.1 exhibited S. aureus binding in a linear range of 10(3) to 10(8) CFU/mL and a limit of detection (LOD) of 10(3) CFU/mL. | 11 | Bead-based Binding Assay | 263.8 ± 78 nM | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1951 | 10451913 | 1999 | In vitro selection of DNA aptamers to anthrax spores with electrochemiluminescence detection | Aptamer pool | N/A | N/A | N/A | ssDNA | Bacillus Anthracis (BA) | Anthrax spores | Develop an aptamer–magnetic bead-electrochemiluminescence (AM-ECL) sandwich assay for detecting anthrax spores. | Display broad dynamic range equivalent to 10– 6×10(6) anthrax spores. | 4 | ECL-based and Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1971 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4936–4 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 3.1 nM | Detection | SELEX | 5-tyrosylaminocarbonyl-dU (TyrdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1972 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4939–280 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 1.6 nM | Detection | SELEX | 5-naphthylmethylaminocarbonyl-dU (NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1973 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4943–51 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | Developed toxin assays show a limit of detection of 1 pmol/L (300 pg/mL) and a 3-log dynamic range. | 8 | Equilibrium Binding Assay | 1.3 nM | Detection | SELEX | 5-tyrosylaminocarbonyl-dU (TyrdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1974 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5564–89 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 9.8 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1975 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5570–54 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 6.6 nM | Detection | SELEX | 5-phenylethyl-1-aminocarbonyl (PEdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1976 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4937–55 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.76 nM | Detection | SELEX | 5-tyrosylaminocarbonyl-dU (TyrdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1977 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4938–17 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.45 nM | Detection | SELEX | 5-benzylaminocarbonyl-dU (BndU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1978 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4940–23 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | Developed toxin assays show a limit of detection of 1 pmol/L (300 pg/mL) and a 3-log dynamic range. | 8 | Equilibrium Binding Assay | 0.07 nM | Detection | SELEX | 5-naphthylmethylaminocarbonyl-dU (NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1979 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4944–30 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.08 nM | Detection | SELEX | 5-tryptaminocarbonyl-dU (TrpdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1980 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5566–74 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.04 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1981 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5573–4 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.07 nM | Detection | SELEX | 5-phenylethyl-1-aminocarbonyl (PEdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1982 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4758–6 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, A chain (CdtA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.22 nM | Detection | SELEX | 5-tryptaminocarbonyl-dU (TrpdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1983 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5574–49 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, A chain (CdtA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 1.1 nM | Detection | SELEX | 5-phenylethyl-1-aminocarbonyl (PEdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1984 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5579–11 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, A chain (CdtA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.05 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1985 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5579–12 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, A chain (CdtA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | Developed toxin assays show a limit of detection of 1 pmol/L (300 pg/mL) and a 3-log dynamic range. | 8 | Equilibrium Binding Assay | 0.69 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1986 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5556–51 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, B chain (CdtB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 6.9 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1987 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5556–67 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, B chain (CdtB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 4.4 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1988 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4520–8 | PCGGCPPCGGGPACCPAPPAPCGGPPPAGCCCAGPCAGAA | 40 | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Staphylococcus aureus Protein A (SpA) | Developed slow off-rate modified aptamer (SOMAmer) reagents against S. aureus cell surface-associated proteins, used to capture and detect S. aureus. | Efficient capture of Staph. aureus over a wide range of cell densities from 5 × 10(2) CFU/ml to 5 × 10(9) CFU/ml. | 8 | Radiolabel Filter Binding Assay | 0·22 nM | Detection | SELEX | P=NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1989 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4503–73 | AZCZGGZZCAAAGZGGCGAZZGGGCAZCZGGZZZZZAAGZ | 40 | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor A (ClfA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | Efficient capture of Staph. aureus over a wide range of cell densities from 5 × 10(2) CFU/ml to 5 × 10(9) CFU/ml. | 8 | Radiolabel Filter Binding Assay | 0·79 nM | Detection | SELEX | Z=BndU (5-benzylaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1990 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4531–56 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Staphylococcus aureus Protein A (SpA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | Able to bind whole cells of all Staph. aureus strains tested, with a detection limit of approx. 10(4) cells per well (10(5)-10(6) cells/ml). | 8 | Radiolabel Filter Binding Assay | 0·03 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1991 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4522–5 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor A (ClfA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·35 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1992 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4504–27 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor B (ClfB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 1·35 nM | Detection | SELEX | BndU (5-benzylaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1993 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4511–67 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor B (ClfB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 3·90 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1994 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4523–79 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor B (ClfB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·47 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1995 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4726–44 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding Protein A (FnbA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 4·38 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1996 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4745–51 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding Protein A (FnbA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·63 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1997 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4506–13 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding protein B (FnbB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 4·73 nM | Detection | SELEX | BndU (5-benzylaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1998 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4516–29 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding protein B (FnbB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·63 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1999 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4527–83 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding protein B (FnbB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·84 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2000 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4727–62 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein A (IsdA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·73 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2001 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4746–3 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein A (IsdA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·16 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2002 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4728–7 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein B (IsdB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·14 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2003 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4747–90 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein B (IsdB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 1·98 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2004 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4507–52 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein C (IsdC) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·15 nM | Detection | SELEX | BndU (5-benzylaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2005 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4517–71 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein C (IsdC) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·08 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2006 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4528–22 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein C (IsdC) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·07 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2007 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4731–69 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein H (IsdH) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 1·30 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2008 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4730–3 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | SasD | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 2·17 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2023 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 4948-1 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85A (Rv3804c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.05 nM | Biosensor | N/A | NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2024 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 4953-64 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85A (Rv3804c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.06 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2025 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 12073-8 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85A (Rv3804c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.09 nM | Biosensor | N/A | NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2026 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 12073-32 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85A (Rv3804c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.16 nM | Biosensor | N/A | NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2027 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 12092-7 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85A (Rv3804c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.06 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2028 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14492-7 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85A (Rv3804c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.24 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2029 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14492-11 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85A (Rv3804c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.21 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2030 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14504-6 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85A (Rv3804c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.29 pM, 0.97 pM, 0.92 pM and 7.3 × 10(6) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.07 nM | Biosensor | N/A | PPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2031 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 4949-52 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85B (Rv1886c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 6.39 nM | Biosensor | N/A | NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2032 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 4954-5 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85B (Rv1886c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.31 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2033 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 12074-5 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85B (Rv1886c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.27 pM, 0.18 pM, 0.30 pM and 5.5 × 10(5) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.08 nM | Biosensor | N/A | NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2034 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 12074-11 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85B (Rv1886c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.36 pM, 0.72 pM, 0.18 pM and 1.8 × 10(6) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.14 nM | Biosensor | N/A | NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2035 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 12093-26 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85B (Rv1886c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.26 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2036 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14493-5 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85B (Rv1886c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 1.94 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2037 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14493-16 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85B (Rv1886c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.29 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2038 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14505-57 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85B (Rv1886c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 4.15 pM, 5.13 pM, 55.47 pM and 4 × 10(7) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.13 nM | Biosensor | N/A | PPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2039 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 4950-27 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85C (Rv0129c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.36 pM, 1.80 pM, 0.61 pM and 3.4 × 10(8) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.03 nM | Biosensor | N/A | NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2040 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 4955-49 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85C (Rv0129c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.26 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2041 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 5569-2 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85C (Rv0129c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.23 pM, 0.28 pM, 0.36 pM and 2.6 × 10(7) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.01 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2042 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 5575-1 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85C (Rv0129c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.03 nM | Biosensor | N/A | PEdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2043 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 12075-16 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85C (Rv0129c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 7.39 pM, 5.38 pM, 8.51 pM and 4.9 × 10(8) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.05 nM | Biosensor | N/A | NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2044 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 12075-40 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85C (Rv0129c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.13 nM | Biosensor | N/A | NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2045 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14494-53 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85C (Rv0129c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.03 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2046 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14494-124 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85C (Rv0129c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.14 pM, 0.07 pM, 0.06 pM and 2.7 × 10(7) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.02 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2047 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14506-48 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85C (Rv0129c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.89 pM, 1.98 pM, 2.10 pM and 3.3 × 10(8) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.04 nM | Biosensor | N/A | PPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2048 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14506-76 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | A85C (Rv0129c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.03 nM | Biosensor | N/A | PPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2049 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7604-59 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | ACR (Rv2031c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 17.5 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2050 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7616-43 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | ACR (Rv2031c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 20.3 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2051 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14483-8 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | ACR (Rv2031c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 32 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2052 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7610-49 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | CF30 (Rv0577 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 5.41 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2053 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7618-50 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | CF30 (Rv0577 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 2.2 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2054 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 12089-13 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | CF30 (Rv0577 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 1.83 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2055 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7595-51 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | CH10 (Rv3418c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.43 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2056 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7600-67 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | CH10 (Rv3418c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 9.45 nM | Biosensor | N/A | BndU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2057 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7608-61 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | CH10 (Rv3418c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 11.1 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2058 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 12067-1 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | CH10 (Rv3418c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 7.55 nM | Biosensor | N/A | NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2059 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14488-1 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | CH10 (Rv3418c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.40 pM, 0.84 pM, 1.94 pM and 1.1 × 10(6) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.53 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2060 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14488-3 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | CH10 (Rv3418c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.05 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2061 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7592-57 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | CH602 (Rv0440 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.26 pM, 1.47 pM, 1.98 pM and 3.0 × 10(7) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.46 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2062 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7605-11 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | CH602 (Rv0440 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 1.84 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2063 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14484-4 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | CH602 (Rv0440 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.34 pM, 0.56 pM, 1.20 pM and 2.2 × 10(8) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.5 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2064 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14484-33 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | CH602 (Rv0440 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 3.03 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2065 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14498-14 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | CH602 (Rv0440 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 7.39 nM | Biosensor | N/A | PPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2066 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7606-49 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | DNAK (Rv0350 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.59 pM, 1.53 pM, 2.19 pM and 1.6 × 10(7) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.66 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2067 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14486-2 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | DNAK (Rv0350 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.31 pM, 0.78 pM, 3.03 pM and 7.4 × 10(6) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 1.03 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2068 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7612-56 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | ESXA (Rv3875 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 41.4 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2069 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7620-5 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | ESXA (Rv3875 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 54.7 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2070 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 5557-2 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | ESXB (Rv3874 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.12 pM, 0.32 pM, 0.13 pM and 2.2 × 10(6) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.54 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2071 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 5562-95 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | ESXB (Rv3874 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 4.52 nM | Biosensor | N/A | PEdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2072 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7598-15 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | KAD (Rv0733 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 1.11 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2073 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 12090-3 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | KAD (Rv0733 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 13.2 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2074 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14491-10 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | KAD (Rv0733 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.20 pM, 1.11 pM, 24.55 pM and 7.9 × 10(7) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.08 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2075 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14491-43 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | KAD (Rv0733 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.14 pM, 0.34 pM, 6.19 pM and 3.5 × 10(7) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.12 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2076 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14502-11 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | KAD (Rv0733 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 1.28 nM | Biosensor | N/A | PPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2077 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14502-14 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | KAD (Rv0733 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.83 nM | Biosensor | N/A | PPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2078 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14487-46 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MASZ (Rv1837c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 6.6 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2079 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14499-2 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MASZ (Rv1837c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 8.84 nM | Biosensor | N/A | PPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2080 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14999-10 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MASZ (Rv1837c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 5.27 nM | Biosensor | N/A | NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2081 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14999-49 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MASZ (Rv1837c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 4.67 nM | Biosensor | N/A | NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2082 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 15005-35 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MASZ (Rv1837c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 4.61 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2083 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 15005-42 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MASZ (Rv1837c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 4.08 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2084 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 15013-1 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MASZ (Rv1837c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 8.06 nM | Biosensor | N/A | BndU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2085 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 15013-72 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MASZ (Rv1837c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 8.54 nM | Biosensor | N/A | BndU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2086 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7615-18 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MPT64 protein (Rv1980c) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 12.3 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2087 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14496-43 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MPT64 protein (Rv1980c) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 2.07 nM | Biosensor | N/A | PPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2088 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 5560-59 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MPT51 protein (Rv3803c) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 13.9 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2089 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7619-25 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MPT51 protein (Rv3803c) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 11.1 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2090 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14503-5 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MPT51 protein (Rv3803c) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 21.1 nM | Biosensor | N/A | PPdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2091 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 15001-2 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MTB12 (Rv2376c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.18 pM, 0.11 pM, 0.42 pM and 1.1 × 10(6) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.04 nM | Biosensor | N/A | NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2092 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 15001-29 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MTB12 (Rv2376c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.06 nM | Biosensor | N/A | NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2093 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 15001-182 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MTB12 (Rv2376c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.18 pM, 1.68 pM, 0.93 pM and 3.4 × 10(5) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.05 nM | Biosensor | N/A | NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2094 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 15007-1 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MTB12 (Rv2376c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.24 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2095 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 15007-43 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MTB12 (Rv2376c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.18 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2096 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 15007-48 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | MTB12 (Rv2376c gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.18 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2097 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 5558-86 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | PSTS1 (Rv0934 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 11.5 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2098 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7622-15 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | PSTS1 (Rv0934 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 6.68 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2099 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14485-44 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | PSTS1 (Rv0934 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 5.75 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2100 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14485-59 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | PSTS1 (Rv0934 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 9.1 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2101 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7587-49 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | RL7 (Rv0652 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.26 pM, 2.47 pM, 1.05 pM and 1.2 × 10(8) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.07 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2102 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7596-2 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | RL7 (Rv0652 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | Exhibit LOD of 0.08 pM, 0.70 pM, 1.35 pM and 3.4 × 10(7) cells/ml in Buffer, Normal serum(40%), Urine protein (100 μg) and serum bacterial load, respectively. | N/A | Radiolabel Equilibration Binding Assay | 0.13 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2103 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 12087-24 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | RL7 (Rv0652 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 11.1 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2104 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14489-14 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | RL7 (Rv0652 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.11 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2105 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14489-18 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | RL7 (Rv0652 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.04 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2106 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 7609-13 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | TPX (Rv1932 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 3.56 nM | Biosensor | N/A | TrpdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2107 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14490-6 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | TPX (Rv1932 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 0.72 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2108 | 28794178 | 2017 | Potential of High-Affinity, Slow Off-Rate Modified Aptamer Reagents for Mycobacterium tuberculosis Proteins as Tools for Infection Models and Diagnostic Applications | 14490-127 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (NR-14865; BEI Resources) | TPX (Rv1932 gene) | Slow-off-rate modified aptamer (SOMAmer) for detecting TB. | N/A | N/A | Radiolabel Equilibration Binding Assay | 1.5 nM | Biosensor | N/A | 2NapdU and 5′PBDC (photocleavable biotin, D spacer, Cyanine3 (Cy3) Labeled) and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2109 | https://doi.org/10.1007/s00604-017-2453-3 | 2017 | Orientation selection of broad-spectrum aptamers against lipopolysaccharides based on capture-SELEX by using magnetic nanoparticles | EA10 | N/A | N/A | 5'-ATAGGAGTCACGACGACCAG-40N-TATGTGCGTCTACCTCTTGA-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50671) | Lipopolysaccharide (LPS) lipid A domain | Identify aptamers that bind to the LPS target. | N/A | 15 | Fluorescence Binding Assay | 28 ± 4 nM | Detection | Orientation selection based on Capture-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2110 | https://doi.org/10.1007/s00604-017-2453-3 | 2017 | Orientation selection of broad-spectrum aptamers against lipopolysaccharides based on capture-SELEX by using magnetic nanoparticles | EA7 | N/A | N/A | 5'-ATAGGAGTCACGACGACCAG-40N-TATGTGCGTCTACCTCTTGA-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50671) | Lipopolysaccharide (LPS) lipid A domain | Identify aptamers that bind to the LPS target. | EA7 binds to the lipid A region of LPS and exhibits a detection limit of 3 ng/mL and a linear range of 5–250 ng/mL. | 15 | Fluorescence Binding Assay | 102 ± 17 nM | Detection | Orientation selection based on Capture-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2111 | https://doi.org/10.1007/s00604-017-2453-3 | 2017 | Orientation selection of broad-spectrum aptamers against lipopolysaccharides based on capture-SELEX by using magnetic nanoparticles | EA5 | N/A | N/A | 5'-ATAGGAGTCACGACGACCAG-40N-TATGTGCGTCTACCTCTTGA-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50671) | Lipopolysaccharide (LPS) lipid A domain | Identify aptamers that bind to the LPS target. | N/A | 15 | Fluorescence Binding Assay | 149 ± 30 nM | Detection | Orientation selection based on Capture-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2119 | 30245324 | 2018 | Aptamer functionalized MoS2-rGO nanocomposite based biosensor for the detection of Vi antigen | Anti-Vi aptamers population | N/A | N/A | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Salmonella Typhi | Vi polysaccharide antigen (Vi antigen) | Developed a novel aptamer functionalized MoS2-rGO-based electrochemical aptasensor for Vi polysaccharide antigen-mediated detection of enteric fever. | Responded linearly in the range between 0.1 ng/mL to 1000 ng/mL with a detection limit of 100 pg/mL. | 6 | Saturation Binding Assay | 638.6 nM | Biosensor | SELEX | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |