Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 267
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0009 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F1-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-ACUGUCCUCCCUUCAGAGAGCGCGGGACCCUUAACUUGGGGCCCACGAACAGCUUCAGUUCCGUCUCGGCGU-CAUAUGUGCGUCUACAUGGAUCCUCA | 140 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | Addition of aptamer F1-1 in a 1000-fold excess over the colicin E3 CRD completely restored protein synthesis. | 12 | Nitrocellulose Filter Binding Assay | 2 ± 11 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0010 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F2-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-UCCCUGGCCCAAGAUCCUAAUAAAGUUUUUUCGGACCGGAGCGAAACCACUAUCCUCUUAAGCAAUCUGU-CAUAUGUGCGUCUACAUGGAUCCUCA | 138 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | Addition of aptamer F2-1 in a 1000-fold excess over the colicin E3 CRD completely restored protein synthesis. | 12 | Nitrocellulose Filter Binding Assay | 14 ± 2 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0011 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F3-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GUACAACACAUCAUUACGGCUGCUAUUGGCUCCAAGCGUCUUUCUCCCUGGUCAAUAGUCCAGCCACCACG-CAUAUGUGCGUCUACAUGGAUCCUCA | 139 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | N/A | 12 | Nitrocellulose Filter Binding Assay | 4 ± 15 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0012 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F4-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GACAUCUGUAAGUAAGAUUCUAUCUGCAAAGCGGUUAGGAGGGCUCGGACUCUGAUUGCCUCCCCGCACC-CAUAUGUGCGUCUACAUGGAUCCUCA | 138 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | N/A | 12 | Nitrocellulose Filter Binding Assay | 7 ± 1 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0013 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F5-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GUCAGCUGCUCGCGGGAUCGAUCCAUUCGGUGGCCAUGCUCCGGAAGAGGCUUCGCAAGACUCAGG-CAUAUGUGCGUCUACAUGGAUCCUCA | 134 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | N/A | 12 | Nitrocellulose Filter Binding Assay | 10 ± 1 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0014 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F4-2 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GACAUCUGUAAGUAAGAUUCUAUCUGCAAAGCGGUUAGGGGGGCUCGGACUCUGAUUGCCUCCCCGCACC-CAUAUGUGCGUCUACAUGGAUCCUCA | 138 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | N/A | 12 | Nitrocellulose Filter Binding Assay | 294 ± 170 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0015 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.4 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-UCACUGUUAUCCGAUAGCAGCGCGGGAUGA-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | 2.0 μg of RNA aptamer S-PS8.4 effected ca. 71% inhibition of cell invasion by pil+ S. enterica serovar Typhi A21-6 but only ca. 19% inhibition in the case of the pilS::Kmr mutant. | 8 | Nitrocellulose Filter Binding Assay | 8.56 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0016 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.3 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-AUUACCUAGAGCGGGAUAAAGUAUAGGUU-GGGUCAAUGCGUCAUA | 87 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0017 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.2 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-CAUCGAGGAGGCGGGAUAUUCGAUGAGUU-GGGUCAAUGCGUCAUA | 87 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0018 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.5 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-GAGUACGAGCGGGAUAGUAAUCGGGUGAU-GGGUCAAUGCGUCAUA | 87 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0019 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.6 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-GAAGGGGUCCGGCUCGGGUGAGGGUCGGGU-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0020 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.9 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-AGCUAGCGGGGGGGCUCGACGGUGGUGGGUU-GGGUCAAUGCGUCAUA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0021 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.7 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-UAGCGGGAGCUUGGACCUGGUGGUCGCGGC-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0022 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.1 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-UUGGGAUCAGCUCGGCGCUGGAGGAGGGGC-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0023 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.8 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-AACUGUACAUGGGCGCAACAGGGAGUUAGC-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0024 | 17188871 | 2007 | In vitro selection of RNA aptamer against Escherichia coli release factor 1 | Class II-1 | GGACCGAGAAGUUACCCUGUAAUCUUAGGAUGAAUCGCAUGCUCUAGCGACCUUUUCGGCUUCGGCGUACGCACAUCGCAGCAAC | 85 | N/A | ssRNA | Escherichia Coli (E. Coli) | Release factor 1 (RF-1) | Identify aptamers that bind to and inhibit the action of RF-1 to enhance the efficiency of nonsense suppression. | Aptamer class II-1 (12 μM) increased the suppression efficiency (44% → 89%). | 11 | Surface Plasmon Resonance (SPR) | 30 ± 6 nM | Therapeutics | SELEX | 3'-Biotinylated (Biotin-d(A)11) or 3'-TexasRed Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0026 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L1F | ATCCGTCACCCCTGCTCTCGTCGCTATGAAGTAACAAAGATAGGAGCAATCGGGTGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0027 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L3F | ATCCGTCACACCTGCTCTAACGAAGACTGAAACCAAAGCAGTGACAGTGCTGAATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0028 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L4F | ATCCGTCACACCTGCTCTCGGTGACAATAGCTCGATCAGCCCAAAGTCGTCAGATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0029 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L6F | ATCCGTCACACCTGCTCTAACGAAATAGACCACAAATCGATACTTTATGTTATTGGTGTTGGCTCCCGTAT | 71 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0030 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L7F | ATCCGTCACACCTGCTCTGTCGAATGCTCTGCCTGGAAGAGTTGTTAGCAGGGATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0031 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L8F | ATCCGTCACACCTGCTCTTAAGCCGAGGGGTAAATCTAGGACAGGGGTCCATGATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0032 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L9F | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0033 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L10F | ATCCGTCACACCTGCTCTGGTACGAATCACAGGGGATGCTGGAAGCTTGGCTCTTGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0034 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L1R | ATACGGGAGCCAACACCACCCGATTGCTCCTATCTTTGTTACTTCATAGCGACGAGAGCAGGGGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0035 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L3R | ATACGGGAGCCAACACCATTCAGCACTGTCACTGCTTTGGTTTCAGTCTTCGTTAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0036 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L4R | ATACGGGAGCCAACACCATCTGACGACTTTGGGCTGATCGAGCTATTGTCACCGAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0037 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L6R | ATACGGGAGCCAACACCAATAACATAAAGTATCGATTTGTGGTCTATTTCGTTAGAGCAGGTGTGACGGAT | 71 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0038 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L7R | ATACGGGAGCCAACACCATCCCTGCTAACAACTCTTCCAGGCAGAGCATTCGACAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0039 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L8R | ATACGGGAGCCAACACCATCATGGACCCCTGTCCTAGATTTACCCCTCGGCTTAAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0040 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L9R | ATACGGGAGCCAACACCACATAACTTCCTTCTTAGTCATGCTGAGCCGGCCAGTAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0041 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L10R | ATACGGGAGCCAACACCAAGAGCCAAGCTTCCAGCATCCCCTGTGATTCGTACCAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0054 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 2F | CATCCGTCACACCTGCTCTG-GTTCGCCCCGGTCAAGGAGA-GTGGTGTTGGCTCCCGTATC | 60 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | Best Candidate | N/A | N/A |
| ABdb_0055 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 5R | GATACGGGAGCCAACACCAC-TAACTTGTTGCTGATCTTAT-CAGAGCAGGTGTGACGGATG | 60 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | Best Candidate | N/A | N/A |
| ABdb_0056 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 2R | GATACGGGAGCCAACACCAC-TCTCCTTGACCGGGGCGAAC-CAGAGCAGGTGTGACGGATG | 60 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | N/A | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | N/A | N/A | N/A |
| ABdb_0057 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 5F | CATCCGTCACACCTGCTCTG-GATAAGATCAGCAACAAGTTA-GTGGTGTTGGCTCCCGTATC | 61 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | N/A | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | N/A | N/A | N/A |
| ABdb_0058 | 19751419 | 2009 | Antibiotic resistance in bacteria: novel metalloenzyme inhibitors | Metallo-β-lactamase-targeting aptamers | CGCGAGCTCCGCGCG-AACCAAACTTGGATCGGTGCACATGTCGAA-CGCGCGCATATGGCGC | 61 | 5'-CGCGAGCTCCGCGCG-N30-CGCGCGCATATGGCGC-3' | ssDNA | Bacillus Cereus 5/B/6 and Escherichia Coli (E. Coli) TAP56 | Metallo-β-lactamase active sites | Identify aptamers that bind and inhibit the hydrolytic enzyme activity by interfering with the active-site metal ions of the β-lactamase enzyme. | LC50 values in the presence of 5 μM cephalexin: 75 μM and 32 μM for B. cereus 5/B/6 and E. coli TAP56, respectively. | 21 | Metallo-β-lactamase activity assays | Ki = 0.92 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0059 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 19 | TAGGGAATTCGTCACGGATCC-GGCGTCCACTCCCAGCCGCTCACTAGTTTCTGCGTGGGTGA-CTGCAGGTCGACGCATGCGCCG | 84 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | Survival rate of mice with LPS-induced sepsis increased from 10% to 75% after treatment. | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0060 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 18 | TAGGGAATTCGTCACGGATCC-GGCGTCCACTCCCAGCCGGTCACTAGTTTCTGCGTGGGTGA-CTGCAGGTCGACGCATGCGCCG | 84 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0061 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 31 | TAGGGAATTCGTCACGGATCC-GGAGAATAACGACAAAAGGTAAACTACAGGCCCGGAGC-CTGCAGGTCGACGCATGCGCCG | 81 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0062 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 14 | TAGGGAATTCGTCACGGATCC-AAAAGTCCTTGCAAGATAGACGCAGCCAGCCGGGTAGTC-CTGCAGGTCGACGCATGCGCCG | 82 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0063 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 25 | TAGGGAATTCGTCACGGATCC-CTTGGCGTTACTTACCTGTACGTCGTAGAG-CTGCAGGTCGACGCATGCGCCG | 73 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0064 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 43 | TAGGGAATTCGTCACGGATCC-TGAACGACGTCGCATTAGCGAGTAGGTTTACGAAGTAAGA-CTGCAGGTCGACGCATGCGCCG | 83 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0075 | 20452328 | 2010 | In vitro selection of RNA aptamers that inhibit the activity of type A botulinum neurotoxin | S132B-C11 | GGGAGGAGGAGAGAUGUGAACUU-AUUCGGGCCCAGGAACCAACUAUAUAAAUGUCCCGAAUGCUUCGACG-AGAAACUCUACACUGGACUGGCG | 93 | 5'-GGGAGGAGGAGAGATGTGAACTT-N47-AGAAACTCTACACTGGACTGGCG-3' | ssRNA | Clostridium Botulinum | Botulinum neurotoxins (BoNT)-light chain of type A (BoNT/A) | Identify aptamers against the light chain of type A BoNT (BoNT/A) and inhibit the endopeptidase activity. | IC50 values of 304 ± 13 nM and KI' of 163 nM for C11. | 9 | Nitrocellulose Filter Retention Assay | 186 ± 18 nM | Therapeutics | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and Radiolabelled ([α-33P]-GTP labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0076 | 20452328 | 2010 | In vitro selection of RNA aptamers that inhibit the activity of type A botulinum neurotoxin | S132B-C12 | GGGAGGAGGAGAGAUGUGAACUU-ACAACCCGGAACAACGUCUAACAGUGUACCAUAACCCGGCAUUCA-AGAAACUCUACACUGGACUGGCG | 91 | 5'-GGGAGGAGGAGAGATGTGAACTT-N47-AGAAACTCTACACTGGACTGGCG-3' | ssRNA | Clostridium Botulinum | Botulinum neurotoxins (BoNT)-light chain of type A (BoNT/A) | Identify aptamers against the light chain of type A BoNT (BoNT/A) and inhibit the endopeptidase activity. | IC50 values of 66 ± 2 nM and KI' of 525 nM for C12. | 9 | Nitrocellulose Filter Retention Assay | 111 ± 12 nM | Therapeutics | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and Radiolabelled ([α-33P]-GTP labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0077 | 20452328 | 2010 | In vitro selection of RNA aptamers that inhibit the activity of type A botulinum neurotoxin | S132B-C22 | GGGAGGAGGAGAGAUGUGAACUU-GACAGCGUGCCUAGAAGUCCAAGCUUAAAUAACCACGCUCGACAAGC-AGAAACUCUACACUGGACUGGCG | 93 | 5'-GGGAGGAGGAGAGATGTGAACTT-N47-AGAAACTCTACACTGGACTGGCG-3' | ssRNA | Clostridium Botulinum | Botulinum neurotoxins (BoNT)-light chain of type A (BoNT/A) | Identify aptamers against the light chain of type A BoNT (BoNT/A) and inhibit the endopeptidase activity. | IC50 values of 214 ± 9 nM and KI' of 603 nM for C22. | 9 | Nitrocellulose Filter Retention Assay | 87 ± 20 nM | Therapeutics | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and Radiolabelled ([α-33P]-GTP labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0085 | 21381755 | 2011 | Aptamer-mediated inhibition of Mycobacterium tuberculosis polyphosphate kinase 2 | PPK2 G9 | CCGTAATACGACTCACTATAGGGGAGCTCGGTACCGAATTC-AACACATAGGTTTGGTTAGGTTGGTTGGTTGAATTA-AAGCTTTGCAGAGAGGATCCTT | 99 | 5'-CCGTAATACGACTCACTATAGGGGAGCTCGGTACCGAATTC-N35-AAGCTTTGCAGAGAGGATCCTT-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | PPK2 Enzyme | Identify aptamers that bind to and inhibit the catalytic activities of enzyme PPK2. | Inhibited PPK2 protein with an IC50 of 39.3 ± 10 nM and inhibited the NDK activities of both the LHK and VC PPK2 proteins with IC50 values of >1 μM and 105 ± 5 nM, respectively. | 20 | Isothermal Titration Calorimetry (ITC) | 870 ± 220 nM | Therapeutics | SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0197 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-3 (80nt) | CTCCTCTGACTGTAACCACG-TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0198 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-3 (60nt) | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 7.8 ± 6.1 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0199 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-6 (79nt) | CTCCTCTGACTGTAACCACG-TAACGTACCAAAATGTTGGATTGGATGTTGTACTGGGTT-GCATAGGTAGTCCAGAAGCC | 79 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 53 ± 7 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0200 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-6_54 | TACCAAAATGTTGGATTGGATGTTGTACTGGGTTGCATAGGTAGTCCAGAAGCC | 54 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 6.3 ± 0.58 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0201 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-20_80 | CTCCTCTGACTGTAACCACG-CACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 28 ± 3.8 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0202 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-20_60 | CTCCTCTGACTGTAACCACGCACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis and 43 ± 4% (SE-20, 60nt) in S. enteritidis. | 12 | Flow Cytometry | 7.1 ± 0.62 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0203 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-22_80 | CTCCTCTGACTGTAACCACG-TATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 30 ± 4.1 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0204 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-22_60 | CTCCTCTGACTGTAACCACGTATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 5.3 ± 0.7 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0205 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-11_60 | CTCCTCTGACTGTAACCACGAACGATTCAAGAACTGTTGGTTGTCGGCTTATTTTCGCCA | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 6.9 ± 0.4 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0206 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-34_80 | CTCCTCTGACTGTAACCACG-TGCCGCTAAACGCCGGCTCATCGTTATGCTTTTCATTGCA-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 56 ± 7.1 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0207 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-1_40 | GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGC | 39 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0208 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-6_60 | GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTCGCATAGGTAGTCCAGAAGCC | 61 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0209 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-12_80 | CTCCTCTGACTGTAACCACG-GTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGTC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0210 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-12_60 | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT | 59 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium and 62 ± 12% (ST-12, 60nt) in S. typhimurium. | 12 | Flow Cytometry | 4.5 ± 0.4 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0211 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-20_80 | CTCCTCTGACTGTAACCACG-ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCATC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0212 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-20_40 | ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCAT | 40 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0213 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-33_60 | CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | 51.0 ± 4.3 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0242 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 1 | GCAATGGTACGGTACTTCC-CAACCCCGTCTATCACGTCGCTCTTGCGTTGGTTG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 7.5 ~ 10 nM (for ALS) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0243 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 2 | GCAATGGTACGGTACTTCC-CAACCCCGTCTATCACGTCGCTGTTGCGTTGGTTG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 7.5 ~ 10 nM (for ALS) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0244 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 3 | GCAATGGTACGGTACTTCC-CGCCGCCGCGTTCTCATCGCGTGATGTAGTGTCCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 17.5 ~ 20 nM (for ALS) and 30 ~ 35 nM (for 3O-C12-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0245 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 4 | GCAATGGTACGGTACTTCC-CGCCGGCTTCTCTTGCCGTGATGTAGTGTCCG-CAAAAGTGCACGCTACTTTGCTAA | 75 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 15 nM (for ALS) and 20 ~ 25 nM (for 3O-C12-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0246 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 5 | GCAATGGTACGGTACTTCC-CGGGGCCCGCTTCTGGTGCGGTGTACTAGTGACCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | ALSap-5 at 0.5 µM, about 90% of biofilm, 50.9% reduced pyocyanin secretions, as well as secretions of LasA protease and LasB elastase were inhibited. | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 10 ~ 12.5 nM (for ALS) and 20 nM (for 3O-C12-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | Best Candidate | N/A | N/A |
| ABdb_0247 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 6 | GCAATGGTACGGTACTTCC-CGGGGCGGGCTGTCATGCCCATCCTACCGTGACCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 15 ~ 17.5 nM (for ALS) and 45 ~ 50 nM (for C4-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0248 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 7 | GCAATGGTACGGTACTTCC-CGGGGCGGCCTGTGTTGGCCTACCTAGCGAGACCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 12.5 ~ 15 nM (for ALS) and 35 ~ 40 nM (for C4-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0249 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 8 | GCAATGGTACGGTACTTCC-CGCTGCCCCCTGTCCTGGGTTAGCTAGCGAGAGCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | 86% of pyocyanin secretion was inhibited by 6 µM of ALSap-8, and biofilm formation, and the secretions of LasA protease and LasB elastase were also decreased by 9.3%, 17.5%, and 19% respectively. | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 10 nM (for ALS) and 25 ~ 30 nM (for C4-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | Best Candidate | N/A | N/A |
| ABdb_0343 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL1 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-GGCGCCATAGCGACGGGGCCATTCCAAGAA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | ZXL1 bound to virulent M. tb H37Rv much more strongly (52.2%) than to the other Mycobacteria strains tested, M. smegmatis (2.5%) and BCG (13.9%). LPS-stimulated human DC groups showed that ZXL1 decreased IL-10 production by 31–36% and increased IL-12 production by 52–91%, thereby reducing the progression of infection and bacterial loads in mice and rhesus monkeys. | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 436.3 ± 37.84 nM | Therapeutics/Immunmodulatory | SELEX | Biotinylated or FAM Labeled | ZXL1 showed no significant cytotoxicity at concentrations ranging from 2 to 15 microM at the 168-hour test. | N/A | Best Candidate | N/A | N/A |
| ABdb_0344 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL2 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-AGTCCACGATAATCACACACACGGACACCC-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0345 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL4 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CACGCCCAATAGTGGCTCCAGCTCATCTCT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0346 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL5 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CATCGATGTACCCTACCTACATGTTACGTT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0347 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL6 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-ACCTACAGCGACACCTAACTGAGTAGAACT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0348 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL7 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TACCTAACACTTCCTGCTCCACCTTTATTA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0349 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL8 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CCCTGATTCCCCCTCATCCGATGGACATCT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0350 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL9 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-GACCCTCATGATACCAACCACTCCAGTCAA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0351 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL10 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TATCCCAGTGGCATTAACTACCCACTCGCA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0352 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL3 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TCACGGAGTGAGGGGCTGTTCATTAAGAGA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0353 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL12 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TCGCCTGATAGGTCTGTGATCCAATCCAAT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0354 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL13 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TCTGCTTGCCGCTGATCCGCCAATTCGATC-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0355 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL14 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TCGTGCCGACGCTGCCGAATAGCACTGCAC-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0502 | 26025307 | 2015 | Efficient suppression of biofilm formation by a nucleic acid aptamer | Aptamer 3 | GGGAGCTCAGAATAAACGCTCAA-GGCAGGACAACAGCGTGTAGTATCAGCTTACGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Salmonella Choleraesuis | Flagella | Identify an aptamer that binds to flagella and inhibits biofilm formation by restricting its rotational frequency and covering its binding sites that attach to the matrix surfaces. | 13.8% survival ratio of living cells in biofilms with 1.1 μM aptamer and 5 μg/mL ampicillin sodium. | 14 | Fluorescence Spectroscopy | 41 ± 2 nM | Therapeutics | SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0503 | 26025307 | 2015 | Efficient suppression of biofilm formation by a nucleic acid aptamer | Aptamer 1 | GGGAGCTCAGAATAAACGCTCAA-GGCCAGCAGCGAGTGTGGAGTATTGTGTTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Salmonella Choleraesuis | Flagella | Identify an aptamer that binds to flagella and inhibits biofilm formation by restricting its rotational frequency and covering its binding sites that attach to the matrix surfaces. | N/A | 14 | Fluorescence Spectroscopy | 50 ± 2 nM | Therapeutics | SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0504 | 26025307 | 2015 | Efficient suppression of biofilm formation by a nucleic acid aptamer | Aptamer 2 | GGGAGCTCAGAATAAACGCTCAA-GGGCAGGTGTTATGTGTACTGCTACAGTGTGGTTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Salmonella Choleraesuis | Flagella | Identify an aptamer that binds to flagella and inhibits biofilm formation by restricting its rotational frequency and covering its binding sites that attach to the matrix surfaces. | N/A | 14 | Fluorescence Spectroscopy | 54 ± 2 nM | Therapeutics | SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0505 | 26025307 | 2015 | Efficient suppression of biofilm formation by a nucleic acid aptamer | Aptamer 4 | GGGAGCTCAGAATAAACGCTCAA-GGCACGGCATGTGTGGTATGTGGTGCCTGTACTCG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Salmonella Choleraesuis | Flagella | Identify an aptamer that binds to flagella and inhibits biofilm formation by restricting its rotational frequency and covering its binding sites that attach to the matrix surfaces. | N/A | 14 | Fluorescence Spectroscopy | 53 ± 5 nM | Therapeutics | SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0527 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt1 | ATGCGGATCCCGCGC-CGAGTGAGGGCGAGGCGCGCTCCTGCCGGT-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | IC₅₀ of 28.94 ± 0.002 nM and showed a MIC of 5.36 μg/ml against MDR (M22, M23, and P887) and XDR (X24, X59) strains. | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 1.06 ± 0.10 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0528 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt6 | ATGCGGATCCCGCGC-CGGCCAGGGGACGAGCGCGCCCTGATCGTG-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | IC₅₀of 22.35 ± 0.001 nM and showed MIC of 6.24 μg/ml against MDR (M22, M23, and P887) and XDR (X24, X59) strains. | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 0.210 ± 0.05 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0529 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Apt1_M3 (17-mer) | ATGCGGATCCCGCGC-GAGGGCGAGGCGCGCTC-GCGCAAGCTTCGCGC | 47 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | Significant growth inhibition against MDR-TB and XDR-TB strains of tuberculosis with a very low MIC of 5.36 μg/ml. | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 4.90 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | Mtb-Apt1 (17-mer) and Mtb-Apt6 (20-mer) do not exhibit significant toxicity at the tested concentrations ranging from 0 to 20 μM. | N/A | N/A | N/A | N/A |
| ABdb_0530 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Apt6_M3 (20-mer) | ATGCGGATCCCGCGC-CAGGGGACGAGCGCGCCCTG-GCGCAAGCTTCGCGC | 50 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | Significant growth inhibition against MDR-TB and XDR-TB strains of tuberculosis with a very low MIC of 6.24 μg/ml. | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 364 nM | Therapeutics | DNA-SELEX | 5'-Biotinylated | Mtb-Apt1 (17-mer) and Mtb-Apt6 (20-mer) do not exhibit significant toxicity at the tested concentrations ranging from 0 to 20 μM. | N/A | Best Candidate | N/A | N/A |
| ABdb_0531 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt2 | ATGCGGATCCCGCGC-GGCACCCAGTGTGGCGCGCCTCCCTCCGTC-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | N/A | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 0.286 ± 0.64 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0532 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt3 | ATGCGGATCCCGCGC-GCCCACCTGTGGGGCGCGCCTCCCTCCGTC-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | Showed moderate to lower inhibition specificities. | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 0.677 ± 0.14 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0533 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt4 | ATGCGGATCCCGCGC-GCCCACGTGTGGTGCGCGCCTCCTCGTAGT-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | Showed moderate to lower inhibition specificities. | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 0.956 ± 0.20 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0534 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt5 | ATGCGGATCCCGCGC-GGCACCCAGTGTGGCGCGCCTCCTCGTAGT-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | N/A | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 2.03 ± 0.12 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0535 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt7 | ATGCGGATCCCGCGC-ACGCGACAGCAGTGCGCGCCCCGTCCCGGT-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | N/A | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 1.02 ± 0.13 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0536 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt8 | ATGCGGATCCCGCGC-CGACGGAGGGAGGCGCGCCACACTGGGTGC-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | N/A | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 0.55 ± 0.05 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0537 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt9 | ATGCGGATCCCGCGC-GCACCGGCAGGAGCGCGCCTCGCCCTCACT-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | N/A | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 1.66 ± 0.22 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0538 | 25624325 | 2015 | Neutralization of staphylococcal enterotoxin B by an aptamer antagonist | A11 | ATACCAGCTTATTCAATT-TAGGCGGTGGAGATAGTAAGTGCAATCTAGGCGGTGGAGATAGTAAGTGCAATCTATGCC-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-N60-AGATAGTAAGTGCAATCT3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and block SEB-mediated toxic shock (TSS) in vitro. | Inhibited SEB-mediated PBMC proliferation of 93% and TNF-α, IL-1β, IL-6, IL-2, and IFN-γ in culture supernatants were reduced by 77, 97, 64, 96, and 99%, respectively. 90% survival of mouse models of SEB-induced TSS. | 11 | Fluorescence Spectroscopy | 64 nM | Therapeutics/Immunmodulatory | SELEX | 5′-Polyethylene glycol (PEG) with 5'-Amidation (NH₂) and 3’-Inverted Thymidine (3'-idT) and 5'-Biotinylated or 5'-FITC Labeled | Showed no cytotoxic effects on PBMCs. | N/A | N/A | N/A | N/A |
| ABdb_0539 | 25624325 | 2015 | Neutralization of staphylococcal enterotoxin B by an aptamer antagonist | A2 | ATACCAGCTTATTCAATT-GATCGATCGATCAGTCAGTCGACCAACGCACGACACGCATCGCTCTATCTCGTCGAACAG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-N60-AGATAGTAAGTGCAATCT3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and block SEB-mediated toxic shock (TSS) in vitro. | A2 achieved 34% PBMC proliferation inhibition. | 11 | Fluorescence Spectroscopy | 26 nM | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0540 | 25891472 | 2015 | Antibiotic loaded nanocapsules functionalized with aptamer gates for targeted destruction of pathogen | SA20hp | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Aptamer-gated nanocapsules for the specific targeting of vancomycin to bacteria for the controlled release of vancomycin. | 15-fold increase of efficacy for vancomycin with MIC of 0.420 μg/mL. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-AlexaFluor 488 Labeled and 3'-(PEG)-AGGGCGC-BH1 | MICs of vancomycin-nanoparticles for S. epidermidis (control) were found to be 6.295 µg/mL. | N/A | N/A | N/A | N/A |
| ABdb_0552 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12 | UGUAAUUCUGCCAUUCUUUUUGGGGCGGAAUACAGGAUGU | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | fmA12-functionalized AgNPs resulted in specific S. aureus antimicrobial activity with only a 1.6 ± 1.0% survival of 12598 cells and 51.9 ± 2.0% survival of 10832 cells. | 8 | Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI) | 95 nM (by SPR) and 67.1 ± 6.1 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | 76% fmA12 survives in 10% mouse serum at 37°C over 24 h, and in 50% serum, 85.0% fmA12 survives after 5 h. | N/A | ~52 h for fmA12. | N/A |
| ABdb_0553 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmF07 | AUACGCUGCUCACUAAAGUCGGGAGUACUCCAAUGUUUUC | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 38.9 ± 4.1 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0554 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmE09 | AUCUAGCAAGCACUUGCAAACAUUCGAUAACGGGGAUUC | 39 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 418 ± 112 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0555 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmG12 | UGCCAAUGUAACUCAACACUCUUCAUUGAGCUGUCGGGCA | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI) | 475 nM (by SPR) and 220 ± 24 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0556 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12Δ3 | N/A | N/A | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 69.7 ± 3.5 nM | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0557 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12Δ6 | N/A | N/A | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 63.1 ± 7.3 μM | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0558 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12Δ9 | N/A | N/A | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 69.1 ± 16.7 nM | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0628 | 25841381 | 2015 | Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralization | ABA1 | UUCAGGGACCAGUGUUUGCCUUGUGCCAGUC | 31 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3' | ssRNA | Bacillus Anthracis (BA) | Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain) | Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin. | IC50 value is higher than 15 μM. | 8 | Ribogreen dye-based fluorescence intensity assay | 108 ± 33.4 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0629 | 25841381 | 2015 | Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralization | ABA2 | CCCAUAGUGAGUCGUAUUAAUUG | 23 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3' | ssRNA | Bacillus Anthracis (BA) | Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain) | Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin. | IC50 value is higher than 15 μM. | 8 | Ribogreen dye-based fluorescence intensity assay | 296 ± 57.1 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0630 | 25841381 | 2015 | Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralization | ABA3 | GCGACCCUAUAGUGAGUCGUAUUAAUGCGC | 30 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3' | ssRNA | Bacillus Anthracis (BA) | Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain) | Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin. | IC50 value is higher than 15 μM. | 8 | Ribogreen dye-based fluorescence intensity assay | 388 ± 79.2 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0631 | 25841381 | 2015 | Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralization | ABA4 | GCGCCCCUAUAUGAGUCGUAUUAAUUGCGC | 30 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3' | ssRNA | Bacillus Anthracis (BA) | Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain) | Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin. | IC50 value is higher than 15 μM. | 8 | Ribogreen dye-based fluorescence intensity assay | 105 ± 10.9 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0632 | 25841381 | 2015 | Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralization | ABA5 | GCGCCCCCAUAGUGAGUCGUAUUAAUACGC | 30 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3' | ssRNA | Bacillus Anthracis (BA) | Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain) | Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin. | ABA 5 rescued cells to at least 50% maximum cell viability, with an IC50 value of 5 μM. | 8 | Ribogreen dye-based fluorescence intensity assay | 205 ± 69.8 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0676 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A24P (Parental) | AGCAGCACAGAGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCTATGCGTGCTACCGTGAA | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | 5′-α-Gal, 3′-FAM α20A24P significantly increased phagocytosis in the presence of either transgenic mouse IgG or hIVIG. | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled, 5′-α-Gal or Biotin-TEG modified | N/A | N/A | N/A | N/A | N/A |
| ABdb_0677 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A24P.A2 | AGCACAGAGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCTATGCGTGCT | 69 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0678 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A24P.A3 | AGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCC | 52 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | 5′-α-Gal α20A24P.A3 significantly increased phagocytosis in the presence of either transgenic mouse IgG or human IVIG. | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled and 5′-α-Gal | N/A | N/A | N/A | N/A | N/A |
| ABdb_0679 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A24P.A4 | AGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCA | 53 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0680 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A24P.A5 | AGGTCAGATGGGGGGAAGACAC | 22 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0681 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A24P.A6 | AAGGCCGGGGTGAAGTGTAGAGGCCTA | 27 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0682 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A24P.A8 | TGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGC | 43 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0683 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A24P.A9 | AGAGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCTAT | 57 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0684 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 15A3P | TTCACGGTAGCACGCATAGGGACAGCAAGCCCAAGCTGGGTGTGCAAGGTGAGGAGTGGGCATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0685 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A1P | TTCACGGTAGCACGCATAGGCAGAACGCACCCGCACACCTCCATCACTCGCATGCACCCCCATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0686 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A8P | AGCAGCACAGAGGTCAGATGCCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCCCCTATGCGTGCTACCGTGAA | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0687 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A8 | CCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCC | 40 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0688 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A9P | AGCAGCACAGAGGTCAGATGCACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGGCCTATGCGTGCTACCGTGAA | 79 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0689 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A9 | CACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGG | 39 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0690 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A12P | TTCACGGTAGCACGCATAGGGCCCGACACTCGTCCACCCGATACCTCTCATGTGTCCCCATCTGACCTCTGTGCTGCT | 78 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0691 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A14P | AGCAGCACAGAGGTCAGATGGGCATGGGGAAGAGAAAGCGGGATAACTTCGTTACCGGGCCCTATGCGTGCTACCGTGAA | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0730 | 27424215 | 2016 | Gold nanoparticle-DNA aptamer conjugate-assisted delivery of antimicrobial peptide effectively eliminates intracellular Salmonella enterica serovar Typhimurium | AptHis (6H7) | GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC | 40 | N/A | ssDNA | Salmonella typhimurium infected HeLa cells | S. typhimurium Whole cell | His-aptamer conjugated AuNP platform for the loading of His-tagged AMP (C-terminally hexahistidine-tagged A3-APO (A3-APOHis) AMPs) to eliminate intracellular S. Typhimurium cells. | 80% viability increase of infected HeLa cells and 100% survival rate of infected mice. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Thiolated (A10-Thiol) and Cyanine5 (Cy5) Labeled | AuNP-Apt(His)-A3-APO(His) led to the increased viability of S. Typhimurium-infected HeLa cells. | ∼80% of A3-APOHis remained in serum after 48 h of incubation with AuNP-Apt(His)-A3-APO(His). | N/A | N/A | N/A |
| ABdb_0753 | 27529508 | 2016 | A Single ssDNA Aptamer Binding to Mannose-Capped Lipoarabinomannan of Bacillus Calmette-Guérin Enhances Immunoprotective Effect against Tuberculosis | BM2 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CCCCATGAACTAGGCTCCACAATGAGTTTGG-GGGTCAATGCGTCATA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N31-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Bovis (bacillus Calmette–Guérin (BCG)) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identified aptamers against ManLAM and served as an immune enhancer for BCG against M. tb H37Rv infection via blocking MR binding, triggering ManLAM–CD44 signalling, and enhancing M1 macrophage and Th1 activation via cellular surface CD44 in vitro and in vivo. | Ki of BM2 was estimated to be 10.34 ± 0.27 nM, with a LOD of 1 × 10^4 cfu/100 μL of BCG. | 10 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 8.59 ± 1.23 nM | Therapeutics/Immunmodulatory | SELEX | Biotinylated | BM2 was demonstrated to be safe with low toxicity based on in vitro and in vivo toxicity analyses. | BM2–BCG complex could be detected and remained stable for at least 30 days in vivo. | N/A | N/A | N/A |
| ABdb_0754 | 27529508 | 2016 | A Single ssDNA Aptamer Binding to Mannose-Capped Lipoarabinomannan of Bacillus Calmette-Guérin Enhances Immunoprotective Effect against Tuberculosis | BM1 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CGGTCGTAGACCGGGAGTTGTTGTTAGTTCA-GGGTCAATGCGTCATA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N31-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Bovis (bacillus Calmette–Guérin (BCG)) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identified aptamers against ManLAM and served as an immune enhancer for BCG against M. tb H37Rv infection via blocking MR binding, triggering ManLAM–CD44 signalling, and enhancing M1 macrophage and Th1 activation via cellular surface CD44 in vitro and in vivo. | N/A | 10 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0755 | 27529508 | 2016 | A Single ssDNA Aptamer Binding to Mannose-Capped Lipoarabinomannan of Bacillus Calmette-Guérin Enhances Immunoprotective Effect against Tuberculosis | BM4 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CGCGCAGCGGGTCGACTTCATTCCTCACCAT-GGGTCAATGCGTCATA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N31-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Bovis (bacillus Calmette–Guérin (BCG)) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identified aptamers against ManLAM and served as an immune enhancer for BCG against M. tb H37Rv infection via blocking MR binding, triggering ManLAM–CD44 signalling, and enhancing M1 macrophage and Th1 activation via cellular surface CD44 in vitro and in vivo. | N/A | 10 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0756 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S3 | ATACCAGCTTATTCAATT-CCCGCCTCTGAGCATTATTAATGTTATACCTTACGGCTGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | Inhibited PBMCs proliferation with an inhibition rate of 84% and reduced IFN-γ, TNF-α, IL-2, and IL-6 secretions by 89%, 87%, 73%, 69%, respectively. PEGS3 allowed 79% of the mice to survive the lethal challenge. | 9 | Enzyme-Linked Aptamer Assay (ELAA) | 36.93 ± 7.29 nM | Therapeutics/Immunmodulatory | SELEX | 5′-Polyethylene glycol (PEG) with 5'-Amidation (NH₂) and 3’-Inverted Thymidine (3'-idT) and 5'-Biotinylated or 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0757 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S6 | ATACCAGCTTATTCAATT-GCCGCGGAATTGTGGCTTGGTGTCGTGGTCAGGGGCTGG-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | N/A | 9 | Enzyme-Linked Aptamer Assay (ELAA) | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0758 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S12 | ATACCAGCTTATTCAATT-GCCACTGTGGACTTGTTATTCGTCTTTGCCGTCTAATTCG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | Inhibited PBMCs proliferation with an inhibition rate of 84%. | 9 | Enzyme-Linked Aptamer Assay (ELAA) | 79.35 ± 12.09 nM | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0759 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S23 | ATACCAGCTTATTCAATT-GCAACAATGTTGTGTCAGCAAGTTGGTTGGCGGTGTATTG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | N/A | 9 | Enzyme-Linked Aptamer Assay (ELAA) | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0760 | https:doi.org10.1016j.carbon.2016.04.014 | 2016 | Biodegradable graphene oxide and polyaptamer DNA hybrid hydrogels for implantable drug delivery | Polyaptamer (PA) | ATCGGCTAGCACGTACAGAACTAAAAAAAAAAAA-GTCGGCTTAGCCTCAACCCCC-AAGGCAAAAAGGCAT | 70 | N/A | ssDNA | Escherichia Coli (E. Coli) and Staphylococcus aureus (S. aureus) | Kanamycin (Kan) | Kan-loaded PA-GO (Kan/PA-GO) hybrid hydrogels for antibacterial effects. | Significantly reduced the viability of E. coli and S. aureus to 24.2 ± 4.8% and 17.7 ± 0.7%, respectively. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-Phosphate | N/A | N/A | N/A | N/A | N/A |
| ABdb_0773 | 27427891 | 2016 | An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteria | E1 | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Composite (TiO2-Apc) for enhanced photodynamic inactivation of target-specific bacteria. | TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation. | N/A | Fluorescence Spectroscopy | 12.4 nM | Therapeutics | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0774 | 27427891 | 2016 | An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteria | E2 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Enhanced photodynamic inactivation via aptamer-functionalized TiO₂ particles. | TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation. | N/A | Fluorescence Spectroscopy | 25.2 nM | Therapeutics | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0775 | 27427891 | 2016 | An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteria | E10 | GCAATGGTACGGTACTTCCGTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGGCAAAAGTGCACGCTACTTTGCTAA | 90 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Enhanced photodynamic inactivation via aptamer-functionalized TiO₂ particles. | TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation. | N/A | Fluorescence Spectroscopy | 14.2 nM | Therapeutics | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0823 | 28069377 | 2017 | Development of an aptamer-ampicillin conjugate for treating biofilms | Aptamer 3 | GGGAGCTCAGAATAAACGCTCAA-GGCAGGACAACAGCGTGTAGTATCAGCTTACGGTG-TTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Salmonella Choleraesuis | Flagella | Aptamer-ampicillin conjugate (Apt3-Amp) to inhibit biofilm formation. | Biofilms containing the conjugate had the lowest survival ratio (37.22 ± 1.12%) compared with control conjugates. | 14 | Fluorescence Spectroscopy | 41 ± 2 nM | Therapeutics | Whole Cell-SELEX | 3'-Amidation (NH₂) and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0824 | 28069377 | 2017 | Development of an aptamer-ampicillin conjugate for treating biofilms | Aptamer 1 | GGGAGCTCAGAATAAACGCTCAA-GGCCAGCAGCGAGTGTGGAGTATTGTGTTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Salmonella Choleraesuis | Flagella | Aptamer-ampicillin conjugate (Apt3-Amp) to inhibit biofilm formation. | N/A | 14 | Fluorescence Spectroscopy | 50 ± 2 nM | Therapeutics | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0825 | 28069377 | 2017 | Development of an aptamer-ampicillin conjugate for treating biofilms | Aptamer 2 | GGGAGCTCAGAATAAACGCTCAA-GGGCAGGTGTTATGTGTACTGCTACAGTGTGGTTG-TTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Salmonella Choleraesuis | Flagella | Aptamer-ampicillin conjugate (Apt3-Amp) to inhibit biofilm formation. | N/A | 14 | Fluorescence Spectroscopy | 54 ± 2 nM | Therapeutics | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0826 | 28069377 | 2017 | Development of an aptamer-ampicillin conjugate for treating biofilms | Aptamer 4 | GGGAGCTCAGAATAAACGCTCAA-GGCACGGCATGTGTGGTATGTGGTGCCTGTACTCG-TTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Salmonella Choleraesuis | Flagella | Aptamer-ampicillin conjugate (Apt3-Amp) to inhibit biofilm formation. | N/A | 14 | Fluorescence Spectroscopy | 53 ± 5 nM | Therapeutics | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0832 | 28206680 | 2017 | A single-stranded DNA aptamer against mannose-capped lipoarabinomannan enhances anti-tuberculosis activity of macrophages through downregulation of lipid-sensing nuclear receptor peroxisome proliferator-activated receptor γ expression | ZXL1 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-GGCGCCATAGCGACGGGGCCATTCCAAGAA-GGGTCAATGCGTCATA | 88 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Downregulate PPARγ expression by blocking the binding of ManLAM to MR on macrophages, and ZXL1 enhances IL-1β and IL-12 mRNA expression and cytokine production in ManLAM-treated macrophages but decreases IL-10 production. | The percentage of macrophages that took up iH37Rv decreased from 15.9% to 7.2%, thereby inhibiting ManLAM-induced immunosuppression of DCs. | N/A | N/A | N/A | Therapeutics/Immunmodulatory | N/A | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0833 | 28778062 | 2017 | DNA aptamer functionalized gold nanostructures for molecular recognition and photothermal inactivation of methicillin-Resistant Staphylococcus aureus | Aptamer | ATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA | 75 | 5'-ATCCAGACGTGACGCAGC-N38-TGGACACGGTGGCTTAGTA-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) standard strain 43300 | Whole cell | Aptamer-functionalized gold nanorods (Apt@Au NRs) for inactivation of MRSA with targeted photothermal therapy (PTT). | Over 95% inactivation of MRSA cells within 2 min. | N/A | N/A | N/A | Therapeutics | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0954 | 29051620 | 2017 | Antimicrobial peptide-loaded gold nanoparticle-DNA aptamer conjugates as highly effective antibacterial therapeutics against Vibrio vulnificus | Apt(His) | GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC | 40 | N/A | ssDNA | Vibrio Vulnificus (MO6-24/O) | V. vulnificus-infected HeLa cells | The AuNP-AptHis conjugate delivers the HPA3P(His) peptide into host cells, inducing bacterial cell death by disrupting membrane integrity. | Compared with that of buffer- or AuNP-AptHis-incubated cells, the number of viable V. vulnificus cells in the AuNP-AptHis-HPA3PHis-treated cells decreased by 90% in 10 min. All infected mice injected with AuNP-AptHis-HPA3PHis survived until 120 h. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Thiolated (A10-Thiol) | HPA3PHis and AuNP-Apt(His)-HPA3P(His) did not exhibit cytotoxicity against HeLa cells and mouse erythrocytes up to 10 µM. | N/A | N/A | N/A | N/A |
| ABdb_0964 | 28987879 | 2017 | Thioaptamer targeted discoidal microparticles increase self immunity and reduce Mycobacterium tuberculosis burden in mice | CD44 Thioaptamer (CD44TA) | GAGATTCATCACGCGCATAGTCTTGGGA*CGGTGTTA*A*A*CGA*A*A*GGGGA*CGA*CCCGA*CTA*TGCGA*TGA*TGTCTTC | 74 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CD44 receptor (Mtb-infected murine macrophages) | Develop a targeting system using CD44 thioaptamers (TA)-conjugated discoidal silicon mesoporous microparticles (SMP) to enhance accumulation of these agents/carriers in the infected macrophages in the lungs. | CD44TA-SMP treatment increased IP-10 (CXCL-10), MCP-1, MCP-2, and RANTES, with no change in IL-6 release compared to the control. | N/A | N/A | N/A | Therapeutics | N/A | *= 5'-monothio-dA and 5'-Cyanine5 (Cy5) Labeled | In uninfected murine and human macrophages, SMP and CD44TA-SMP did not affect the cell viability. | N/A | N/A | N/A | N/A |
| ABdb_1002 | 29357405 | 2018 | Combat biofilm by bacteriostatic aptamer-functionalized graphene oxide | ST-3 (or ST-33) | CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG | 60 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Biofilm | Aptamer-GO conjugate reduces the cellular membrane potential to inhibit biofilm formation. | 93.3 ± 3.4% inhibition ratio at the initial stage of biofilm formation and 84.6 ± 5.1% degradation ratio on formed biofilms. | 12 | N/A | N/A | Therapeutics | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1021 | 29098517 | 2018 | Influence of aptamer-targeted antibiofilm agents for treatment of Pseudomonas aeruginosa biofilms | PA-ap1 (F23) | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Aptamer-ciprofloxacin-SWNTs complex for antibiofilm activity. | 90% inhibitory efficiency of complex aptamer-ciprofloxacin-SWNTs on biofilm formation. | 16 | Flow Cytometry | 17.27 ± 5.00 nM | Targeted Delivery/Therapeutics | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1022 | 29580944 | 2018 | Inhibition of anthrax lethal factor by ssDNA aptamers | ML12 (30mer) | CGAGGGAGACGCGAACCTTCTCGCCTTGGG | 30 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Bacillus Anthracis (BA) | Lethal factor (LF) | Identify aptamers against LF and interfere with the interaction with its substrate MEK1 by blocking the active site of LF to prevent protease activity. | Effective inhibitor of LF with an IC₅₀ of 15 ± 1.5 µM and ~85% cell viability. | 8 | Fluorescence Spectroscopy | 11.0 ± 2.7 nM | Therapeutics | SELEX | 3'-Cyanine3 (Cy3) Labeled | In RAW 264.7 cells, the cell viability remained unchanged from 0.08 to 10 µM of ML12, indicating that it appears to be non-toxic. | N/A | Best Candidate | N/A | N/A |
| ABdb_1023 | 29580944 | 2018 | Inhibition of anthrax lethal factor by ssDNA aptamers | ML6 | GGACCAGCCGCCGCGCCTTGACCGGGGGTA | 30 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Bacillus Anthracis (BA) | Lethal factor (LF) | Identify aptamers against LF and interfere with the interaction with its substrate MEK1 by blocking the active site of LF to prevent protease activity. | N/A | 8 | Fluorescence Spectroscopy | N/A | Therapeutics | SELEX | 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1024 | 29580944 | 2018 | Inhibition of anthrax lethal factor by ssDNA aptamers | ML7 | GGAGAGAGGGAGACGCGCAACCTCGACCCGT | 31 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Bacillus Anthracis (BA) | Lethal factor (LF) | Identify aptamers against LF and interfere with the interaction with its substrate MEK1 by blocking the active site of LF to prevent protease activity. | N/A | 8 | Fluorescence Spectroscopy | N/A | Therapeutics | SELEX | 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1025 | 29580944 | 2018 | Inhibition of anthrax lethal factor by ssDNA aptamers | ML12 (60mer) | GCGCGGATCCCGCGC-CGAGGGAGACGCGAACCTTCTCGCCTTGGG-CGCGCGAAGCTTGCG | 60 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Bacillus Anthracis (BA) | Lethal factor (LF) | Identify aptamers against LF and interfere with the interaction with its substrate MEK1 by blocking the active site of LF to prevent protease activity. | N/A | 8 | Fluorescence Spectroscopy | 17.5 ± 4.8 nM | Therapeutics | SELEX | 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1026 | 29964028 | 2018 | Selection of DNA aptamers to Streptococcus pneumonia and fabrication of graphene oxide based fluorescent assay | Lyd-3 | TGACGAGCCCAAGTTACCT-GCCCCCGAACCATACCACACGATGCCCCGTACCCCAGCCACC-AGAATCTCCGCTGCCTACA | 80 | 5'-TGACGAGCCCAAGTTACCT-N42-AGAATCTCCGCTGCCTACA-3' (Library 1) and 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTTCACGGACCCCACT-3' (Library 2) | ssDNA | Streptococcus Pneumoniae | Whole cell | Identify aptamers that bind to and develop a graphene oxide/aptamer-based label-free fluorescent assay to detect Streptococcus pneumoniae and inhibit biofilm formation. | Show a detection limit of 15 cfu mL-1. Biofilm formation was reduced from 100% to 35.8% at a Lyd-3 concentration of 1 μM compared with the no-aptamer control. | 20 | Fluorescence Spectroscopy | 661.8 ± 111.3 nM | Diagnostic/Therapeutics | Whole Cell-SELEX | FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1027 | 29964028 | 2018 | Selection of DNA aptamers to Streptococcus pneumonia and fabrication of graphene oxide based fluorescent assay | Lyd-1 | AAGGGCTGGCTGGGATGGA-CCCTCCCGAAACGAGCTGTCTCTTAACGGAAGCTAATCTGCC-TCACTCCACGGACCCCACT | 80 | 5'-TGACGAGCCCAAGTTACCT-N42-AGAATCTCCGCTGCCTACA-3' (Library 1) and 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTTCACGGACCCCACT-3' (Library 2) | ssDNA | Streptococcus Pneumoniae | Whole cell | Identify aptamers that bind to and develop a graphene oxide/aptamer-based label-free fluorescent assay to detect Streptococcus pneumoniae and inhibit biofilm formation. | At 100 nM of Lyd-1, biofilm formation decreased to 90.8%. | 20 | Fluorescence Spectroscopy | 844.7 ± 123.6 nM | Diagnostic/Therapeutics | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1028 | 29964028 | 2018 | Selection of DNA aptamers to Streptococcus pneumonia and fabrication of graphene oxide based fluorescent assay | Lyd-2 | TGACGAGCCCAAGTTACCT-CACCCGCCTGGCAAAAAACACCACGACATTTTTCTCACCCCC-AGAATCTCCGCTGCCTACA | 80 | 5'-TGACGAGCCCAAGTTACCT-N42-AGAATCTCCGCTGCCTACA-3' (Library 1) and 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTTCACGGACCCCACT-3' (Library 2) | ssDNA | Streptococcus Pneumoniae | Whole cell | Identify aptamers that bind to and develop a graphene oxide/aptamer-based label-free fluorescent assay to detect Streptococcus pneumoniae and inhibit biofilm formation. | At 100 nM of Lyd-2, biofilm formation decreased to 92.6%. | 20 | Fluorescence Spectroscopy | 1984.8 ± 347.5 nM | Diagnostic/Therapeutics | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1085 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-1 | GTCTTGACTAGTTACGCC-TAGGAAGGGAAGGAAGATAGAGAGTAGGTCGTCGGAGGCAGGGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1086 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-2 | GTCTTGACTAGTTACGCC-TAGTAAAGGGGGTAAGAATCAATTGCGAGGTGGAGTGGGAGTGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1087 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-4 | GTCTTGACTAGTTACGCC-TAGGTGATTGCTGGAGTGGGTAGCAGATGGGGGGGGGGTTCTTGG-TCATTCAGTTGGCGCCTC | 81 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1088 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-13 | GTCTTGACTAGTTACGCC-TTTGGGAAGGGGGGGGAGGAAGTTCGATGGTGTTGTGGACCGGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1089 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-1T | TAGGAAGGGAAGGAAGATAGAGAGTAGGTCGTCGGAGGCAGGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1090 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-2T | TAGTAAAGGGGGTAAGAATCAATTGCGAGGTGGAGTGGGAGTGG | 44 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1091 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-4T | TAGGTGATTGCTGGAGTGGGTAGCAGATGGGGGGGGGGTTCTTGG | 45 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | HupB-4T treated bacteria yielded reduced intracellular CFU by ∼57.8%. | 8 | Isothermal Titration Calorimetry (ITC) | 1.72 ± 0.00002 μM, | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | No loss in the viability of THP-1 cells was observed on exposure to aptamers. | In fetal bovine serum (FBS) for 3 hr at 37°C, no change was observed in the integrity of aptamer bands. | Best Candidate | N/A | Patent application no. 20171100124 |
| ABdb_1092 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-13T | TTTGGGAAGGGGGGGGAGGAAGTTCGATGGTGTTGTGGACCGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | HupB-13T treated bacteria yielded reduced intracellular CFU by ∼45.5%. | 8 | Isothermal Titration Calorimetry (ITC) | 0.17 ± 0.00000005 μM | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | No loss in the viability of THP-1 cells was observed on exposure to aptamers. | In fetal bovine serum (FBS) for 3 hr at 37°C, no change was observed in the integrity of aptamer bands. | Best Candidate | N/A | Patent application no. 20171100124 |
| ABdb_1214 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS10-Trunc | GGTGGTGGTGG | 11 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibited MS activity with an IC₅₀ of 251.1 nM; Ki of 230 nM; inhibited M. tb invasion into human THP-1 monocytic cells. | 10 | Surface Plasmon Resonance (SPR) | 1.9 × 10−11 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | Indian Patent application no. 201611021901 |
| ABdb_1215 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS4 | GGACCAGGTGAGTGGATGCGGGTGCGGGTGGGGGTGAGGGGGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 9.9 × 10−9 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1216 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS5 | GCAGAGAGAGAGAAAGTGAGAAGGGCGGGGGGGAGAGGGTGGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 2.7 × 10−6 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1217 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS6 | GGTGGGATGGGGGGGGGAGGGTAGGGTGTGCAAGTAGAGGGTC | 43 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 2.8 × 10−10 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1218 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS10 | GGTGTGTTGACTGAGGGGGTGGGGTGGGTGGTGGTGGATATAGC | 44 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 1.2 × 10−8 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1219 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS20 | GGGTTGTAAGAGGGAGCTGGGAGGGGTCGGGGGGGGGGGTGGC | 43 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 9.1 × 10−7 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1220 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A16 | CCATCCACACTCCGCAAGTGGGGAGGGGAGAGACGACGATCCTGTGGGTTTTCTGCAGTGAGTCGTGTTTTCGACTTATTGCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | 28.47 nM | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1221 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A46 | CCATCCACACTCCGCAAGTATGAGGACAGTTGGAGGGCGCGCCGTGTTTTTTCTGCAGTGAGTCGTGTTTCCTCGCTCACGCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | N/A | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1222 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A1 | CCATCCACACTCCGCAAGTTTTAGGAGTAGTGGTGTGGGGACCGACTCTTTTCTGCAGTGAGTCGTGTTTTCGAGTCATCCCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | N/A | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1223 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A2 | CCATCCACACTCCGCAAGTGAGATGTGGTGTAGGCAACTCGGCATAGATTTTCTGCAGTGAGTCGTGTTTTTTGACACGGCCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | N/A | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1349 | 31953175 | 2020 | Single-stranded DNA (ssDNA) Aptamer targeting SipA protein inhibits Salmonella Enteritidis invasion of intestinal epithelial cells | Apt17 | TAGGGAAGAGAAGGACATATGAT-GCAATGGAACCGCTGAACGACCCTAGCATTATCAGTGTGG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) TM 6 andTM 68 | SipA protein | Identify an aptamer targeting the SipA protein and interfere with the function of effector proteins to prevent host cell invasion. | 70% and 37.7% inhibition ratios against adhesion and invasion of S. enteritidis TM 6 to Caco-2 cells, 45.71% and 39.5% against those of S. enteritidis TM 68, respectively. | 9 | Fluorescence Spectroscopy | 114.9 nM (at 27°C) and 63.4nM (at 37°C) | Therapeutics | Magnetic Bead (MB)-based SELEX | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1350 | 32333113 | 2020 | Inhibitory effects of aptamer targeted teicoplanin encapsulated PLGA nanoparticles for Staphylococcus aureus strains | SA20 | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) susceptible strains and MRSA | Whole cell | Aptamer-PLGA nanoparticles (Apt-teicoplanin-PLGA NPs) for the delivery of teicoplanin antibiotic. | MICs of teicoplanin decreased by 32- and 64-fold for susceptible strains and MRSA strains, respectively. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1351 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 10 colony 5 | CCGGAATTCCTAATACGACTCTACAAAAAGTCGTGGTCCAGTTGCCATGTGTAAAACTGTGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | Exhibited the highest biofilm inhibition towards EPEC K1.1 shown by lowest OD value of 0.126. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1352 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 8 colony 1 | CCGGAATTCCTAATACGACTCTGCGGACTGTATGCGGTACGGTCGAAAATAGTGAAGGTGCTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1353 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 8 colony 4 | CCGGAATTCCTAATACGACTCACTACGCACGGCGCGAGTAAATCGATCATGGTACTGTGGCTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1354 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 8 colony 7 | CCGGAATTCCTAATACGACTCGGTTCCGGTAAGATTAGATCATAACGTATGGCTAGCGCCATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1355 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 9 colony 3 | CCGGAATTCCTAATACGACTCGAAAACGTACCACTGGGATGGGTTGTGGGAGAGGGCCAGGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1356 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 10 colony 10 | CCGGAATTCCTAATACGACTCATCCAGCAGATGTGCGCGGGTTGGTGGGGGAACGGTGGGATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1375 | 32451800 | 2020 | Inhibition of Salmonella enteritidis biofilms by Salmonella invasion protein-targeting aptamer | Apt17 | TAGGGAAGAGAAGGACATATGAT-GCAATGGAACCGCTGAACGACCCTAGCATTATCAGTGTGG-TTGACTAGTACATGACCACTTGA | 86 | N/A | ssDNA | Salmonella Enteritidis (S. Enteritidis) TM 6 andTM 68 | Salmonella invasion proteinA (SipA) | An aptamer targets the SipA protein to inhibit Salmonella biofilm formation by interfering with the T3SS. | Co-incubation of Apt17 with ampicillin MIC/10 for 24 h inhibited the biofilms of S. enteritidis TM 6 and S. enteritidis TM 68 by 12.5% and 20.9% respectively. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1376 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC1 | TACTTCCGCACCCTCCTACA | 20 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1377 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC2 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1378 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC3 | CCCTTTCCCTTTCCCATTCCCGTTCCCTTTCCCTTTCCCATTCCCGTTA | 49 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1379 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC5 | ATGAGAGCGTCGGTGTGGTA-CCCTTTCCCTTTCCCATTCCCGTTCCCTTTCCCTTTCCCATTCCCGTTA-TACTTCCGCACCCTCCTACA | 89 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1380 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC6 | ATGAGAGCGTCGGTGTGGTA | 20 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1455 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C1R1 | TAGGGAAGAGAAGGACATATGAT-GCGCGCGAGATTAACCCCCCAATGCTGCACCGAGCCACGA-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | With 250 cells as the lowest measured cell number by the C1R1. The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | 31 ± 2 nM | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1456 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C2R1 | TAGGGAAGAGAAGGACATATGAT-GCGGCAGGGAAGGACTATGTGGGTGAAAGGAGTGCGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1457 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C2R2 | TAGGGAAGAGAAGGACATATGAT-GCAGCGGGATGGGGTAAATGGTGGCGAGAGGCGTCGGGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1458 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C4R2 | TAGGGAAGAGAAGGACATATGAT-GCGGGTTGACTAGTACATGACCACTTGAGTCGCTTGAACT-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | Labelling efficiency by C4R2 of approximately 60 % fluorescence signal relative to R16 values. The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1459 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C6R3 | TAGGGAAGAGAAGGACATATGAT-GCGGGGAGAGGCGAAAGAAGCTGGGATGGAAGGGCGTAGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1460 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C10R5 | TAGGGAAGAGAAGGACATATGAT-GCAGCCACAGCAGAGACGGGAAGGGCCAGGGTTGAGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1461 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C10R6 | TAGGGAAGAGAAGGACATATGAT-GCGGCGGTGGGGCTTTCGGTGATTTGGGCGGTTTGGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1503 | 34347427 | 2021 | Aptamer-Functionalized DNA-Silver Nanocluster Nanofilm for Visual Detection and Elimination of Bacteria | Apt-G | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACGGGTGGGGTGGGGTGGGG | 80 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | DNA-templated silver nanoclusters (N4-AgNC/Apt-G) for the visual detection and effective elimination of bacteria. | After treatment with 5 μM N4-AgNCs/Apt-G, a significantly reduced number of colonies was observed. At the lowest inhibitory concentration of 6.25 μM, the number of colonies decreased by only 4-fold, which is significantly less than the 7-fold reduction observed at 5 μM. Obtained recovery rates ranging from 88% to 115% of S. aureus. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | N/A | N4-AgNCs/Apt-G was found to be nontoxic at low concentrations, and cell viability was more than 80% at a concentration of 6.25 μM. | N/A | N/A | N/A | N/A |
| ABdb_1540 | 34664941 | 2021 | Efficient Eradication of Bacterial Biofilms with Highly Specific Graphene-Based Nanocomposite Sheets | S. Typhimurium aptamer (ST-NH2) | TTTTTAAGCCCACTGGCGTTCGGACATCACAGCTCGTGCAGGTCGTGCCATG | 52 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CMCC 50115) | Whole cell | ICG@GO-Apt nanosheets for eradication of biofilm associated with Salmonella Typhimurium. | Shows an efficient biofilm elimination with an efficiency of greater than 99.99% in an abscess formation model. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Amidation (NH₂) or TAMRA, 5'-FAM Labeled or Amidation (NH₂) | ICG@GO-Apt NSs had almost no cytotoxicity to HEK 293 cells, with more than 90% and lacked hemolytic activities. | N/A | N/A | N/A | N/A |
| ABdb_1548 | 34396009 | 2021 | DNA Aptamer-Conjugated Magnetic Graphene Oxide for Pathogenic Bacteria Aggregation: Selective and Enhanced Photothermal Therapy for Effective and Rapid Killing | MRSA aptamer | ATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA | 75 | 5'-ATCCAGACGTGACGCAGC-N38-TGGACACGGTGGCTTAGTA-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Apt@MGO nanoplatform for selective and rapid eradication of MRSA under NIR laser irradiation. | Apt@MGO resulted in ∼78% MRSA and over >97% MRSA cell inactivation in dispersed and aggregated states, respectively, under 200 seconds of exposure to NIR irradiation (808 nm, 1.1 W cm–2). | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Amidation (NH₂) and 5'-FITC Labeled | The aptamer itself did not cause any cell activation when incubated with MRSA cells, and also under no NIR laser illumination. | N/A | N/A | N/A | N/A |
| ABdb_1608 | 35745014 | 2022 | The Ability of Nuclease-Resistant RNA Aptamer against Streptococcus suis Serotype 2, Strain P1/7 to Reduce Biofilm Formation In Vitro | R8-su12 | GGGAGUCGACCGACCAGAA-CAUACUGAGUAAGAUCGGAAAUUUCGGUGUAAGGCCACGG-UAUGUGCGUCUACAUCUAGACUCAU | 84 | 5'-AGTAATACGACTCACTATAGGGAGTCGACCGACCAGAA-N40-TATGTGCGTCTACATCTAGACTCAT-3' | ssRNA | Streptococcus Suis serotype 2, strain P1/7 | Whole cell | Identify aptamers that inhibit the biofilm formation of the S. suis target strain. | Significantly reduced biofilm formation by 61.2%. | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Therapeutics | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1609 | 35745014 | 2022 | The Ability of Nuclease-Resistant RNA Aptamer against Streptococcus suis Serotype 2, Strain P1/7 to Reduce Biofilm Formation In Vitro | R8-su057 | GGGAGUCGACCGACCAGAA-UGGAUGUAUGGAACUUGCAGAUCUUAACUGCACGAAGCGU-UAUGUGCGUCUACAUCUAGACUCAU | 84 | 5'-AGTAATACGACTCACTATAGGGAGTCGACCGACCAGAA-N40-TATGTGCGTCTACATCTAGACTCAT-3' | ssRNA | Streptococcus Suis serotype 2, strain P1/7 | Whole cell | Identify aptamers that inhibit the biofilm formation of the S. suis target strain. | N/A | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Therapeutics | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1610 | 35745014 | 2022 | The Ability of Nuclease-Resistant RNA Aptamer against Streptococcus suis Serotype 2, Strain P1/7 to Reduce Biofilm Formation In Vitro | R8-su15 | GGGAGUCGACCGACCAGAA-ACACGUUGCUGAAACAUACCGAGUAACAUAAAGCGGGUG-UAUGUGCGUCUACAUCUAGACUCAU | 83 | 5'-AGTAATACGACTCACTATAGGGAGTCGACCGACCAGAA-N40-TATGTGCGTCTACATCTAGACTCAT-3' | ssRNA | Streptococcus Suis serotype 2, strain P1/7 | Whole cell | Identify aptamers that inhibit the biofilm formation of the S. suis target strain. | N/A | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Therapeutics | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1611 | 35573794 | 2022 | Aptamer-Targeted Drug Delivery for Staphylococcus aureus Biofilm | SA31 | GCAATGGTACGGTACTTCC-TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (DSM 20231) | Whole cell | Aptamer-targeted liposomes encapsulating antibiotics for accumulation and delivery to eradicate S. aureus biofilm. | SA31-modified liposomes fully eradicated all viable, culturable bacteria in all biofilm samples. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-5-propargylamino-ddUTP-Cy5 or 3'-N3 modified | N/A | SA23 appeared more stable than the other aptamers in plasma over a 16-hour incubation period. | N/A | N/A | N/A |
| ABdb_1612 | 35616277 | 2022 | Targeted inhibition of methicillin-resistant Staphylococcus aureus biofilm formation by a graphene oxide-loaded aptamer/berberine bifunctional complex | Aptamer 1 | GGGAGCTCAGAATAAACGCTCAATACTATCGCGGAGACAGCGCGGGAGGCACCGGGGAGATCCGGGCCTCATGTCGAA | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Penicillin binding protein 2a (PBP2a) | Identify a PBP2a-targeted aptamer in conjunction with GO for the delivery of berberine to treat chronic infections caused by MRSA biofilms. | The linear range was 10^3–10^7 CFU/mL, and the detection limit for the fluorescent assay was 800 CFU/mL. The inhibition rate peaked at 92.8% after treatment with the GO-berberine/aptamer 1 (containing 200 nM aptamer 1) complex. | 14 | Fluorescence Spectroscopy | 82.97 ± 8.86 nM | Diagnostic/Therapeutics | SELEX | FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1613 | 35616277 | 2022 | Targeted inhibition of methicillin-resistant Staphylococcus aureus biofilm formation by a graphene oxide-loaded aptamer/berberine bifunctional complex | Aptamer 2 | GGGAGCTCAGAATAAACGCTCAAGGCACACAGGACTATACAGTGTTGCAGTGTTGCTGGATCCGGGCCTCATGTCGAA | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Penicillin binding protein 2a (PBP2a) | Identify a PBP2a-targeted aptamer in conjunction with GO for the delivery of berberine to treat chronic infections caused by MRSA biofilms. | N/A | 14 | Fluorescence Spectroscopy | 152.92 ± 29.26 nM | Diagnostic/Therapeutics | SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1614 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | AptBH | AAACCTGCTTATCTAAGGGGGGGAGGGGGGGTAGTGGGTGGGT | 43 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | AptBH-AgNPs at a concentration of 100 μg/mL after 48 h inhibited 43% of the biofilm formation and degraded 63% of the formed biofilm. | N/A | N/A | N/A | Therapeutics | N/A | 3'-Biotinylated | AgNPs-AptBH is weakly toxic, with cell viability of 96% even at 100 μg/mL. At 75 and 100 μg/mL, these concentrations caused ∼approximately 9% and 11% hemolysis, respectively. | AgNPs-AptBH complex has not decomposed over time for 360 min in the cell culture medium. | Best Candidate | N/A | N/A |
| ABdb_1615 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | SMa#G10-11 | CAACCTGCTTATCTAAGGGGGGGAGGGGGGGTTGTGGGTAGGT | 43 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1616 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | SMa#G11-6 | ATACTATCGCATTCCTTCCGAGGGGGGAGGGGGGGGTGGGGGTCGGT | 47 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1617 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | SMa#G11-5 | ATACATCTTAAGTCTCGTGGGGGGAGGGGGGGTTGGTGGGCTTT | 44 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1618 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | SMa#G11-20 | CTACGTCTAGATTCCAGTCGAGGGGGGAGGGGGGGTTTTGGATCGGT | 47 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1619 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | SMa#G10-6 | ACACCAGCGTATTCTCTTGGGGGGAGGGGGGGTTGGGGGTCGGT | 44 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1620 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-1 | GCATCGGTCCTGAAGTTGCTCTAGTGCCCGTGTGCTCAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1621 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-2 | GGGCTAGCCCCGGATCACCACTTTCCCTGCTTGATGCAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1622 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-3 | TGTAACGGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1623 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-4 | TGGCACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1624 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-5 | CCTAACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1625 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-6 | CGGTTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1626 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-7 | GTGTTTCGCGCTATTTCCGTACAACCCGCGGACGCCTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1627 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | FAM | GCAATGGTACGGTACTTCCCAAAAGTGCACGCTACTTTGCTAA | 43 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1628 | 35842460 | 2022 | DNA-aptamer-nanographene oxide as a targeted bio-theragnostic system in antimicrobial photodynamic therapy against Porphyromonas gingivalis | Aptamer | TATGCCAGCATTTCGCCAACGGTGGTCATACAGTGTGAA | 39 | N/A | ssDNA | Porphyromonas Gingivalis | Whole cell | DNA-aptamer-NGO, a targeted bio-theragnostic system against P. gingivalis for antimicrobial photodynamic therapy (aPDT). | MIC of DNA-aptamer-NGO was 62.5 nM, and MBC was 125 nM. aPDT using 1/2 × and 1/4 × MBC of DNA-aptamer-NGO plus irradiation of the diode laser light (1 min) has a significantly anti-biofilm effect; percentage of apoptosis cells treated with DNA-aptamer-NGO at 1/2 × and 1/4 × MIC plus diode laser were 13.9% and 12.7%; and 1/2 × MIC of DNA-aptamer-NGO, resulted in 40.3% inactivation of metabolic activity compared to 1/4 × MBC of DNA-aptamer-NGO, where only 22.2% inactivation. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | FAM Labeled | At high concentrations of DNA-aptamer-NGO, incubated for 24 hours with human red blood cells, the percentage did not exceed 5%. Also, at different concentrations, the mean percentage of HGF cell viability ranges from 95.2% to 87.6%. | N/A | N/A | N/A | N/A |
| ABdb_1639 | https:doi.org10.1016j.arabjc.2022.104274 | 2022 | Application of G-quadruplex aptamer conjugated MSNs to deliver ampicillin for suppressing S. aureus biofilm on mice bone | PA76 | 3’-ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAATCGTAATCAGTTAG-5’ | 76 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | MSNs-APT-AMP nanosystem for antibiofilm activity against S. aureus biofilm. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1640 | https:doi.org10.1016j.arabjc.2022.104274 | 2022 | Application of G-quadruplex aptamer conjugated MSNs to deliver ampicillin for suppressing S. aureus biofilm on mice bone | PA63 | 3’-ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAAT-5’ | 63 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | MSNs-APT-AMP nanosystem for antibiofilm activity against S. aureus biofilm. | No significant biofilm on the surface of the bone after 48 h treatment with 100 µg/mL of the three-component system. | N/A | N/A | N/A | Therapeutics | N/A | N/A | No significant toxicity at 100 µg/mL for MCF-7 cells in 48 h. | N/A | Best Candidate | N/A | N/A |
| ABdb_1658 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K3 | CCGGAATTCCTAATACGACTCCCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Determine the antibiofilm activity and binding specificity of the polyclonal DNA aptamers on S. aureus BPA-12 and E. coli EPEC 4. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (25.8%) and E. coli EPEC 4 (0.3%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1659 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K4 | CCGGAATTCCTAATACGACTCCCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCCTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (26.3%) and E. coli EPEC 4 (2.8%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1660 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K6 | CCGGAATTCCTAATACGACTCGCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the highest percentage of antibiofilm activity against S. aureus BPA-12 (37.4%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1661 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K13 | CCGGAATTCCTAATACGACTCCACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (31.8%) and E. coli EPEC 4 (9.4%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1662 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K15 | CCGGAATTCCTAATACGACTCCAGGACAGTACTCTGGACGGCAATACGTATATACGTACGGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (19.1%) and E. coli EPEC 4 (-1.3%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1663 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K20 | CCGGAATTCCTAATACGACTCCCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the highest percentage of antibiofilm activity against E. coli EPEC 4 (15.4%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1664 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R6DevR22 (APT-1) | GTCTTGACTAGTTACGCC-CTGCTGGTCTTTAGTCTCTATTGAGTGGCTAAAGTTGAGGCAG-TCATTCAGTTGGCGCCTC | 79 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | Identify an aptamer against DevR and inhibit DevR-dependent transcription by blocking DevR dimerisation and DNA-binding activity in Mycobacterium smegmatis. | APT-1, APT-2, APT-5, and APT-7 exhibited a maximum of ∼40% inhibition of Rv1738 promoter activity. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1665 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R6DevR25 (APT-2) | GTCTTGACTAGTTACGCC-CTGCCTTTTCAAAAGTTTATTGGGATGTACTTTTGTTCAGGCAG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-1, APT-2, APT-5, and APT-7 exhibited a maximum of ∼40% inhibition of Rv1738 promoter activity. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1666 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R6DevR28 (APT-3) | GTCTTGACTAGTTACGCC-CATAAACGCAGTGACGTTCCCAGAATTGTGGCTGATGATTTTGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | N/A | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1667 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R6DevR10 (APT-4) | GTCTTGACTAGTTACGCC-GCGAGAATGTGCGCAAAGTCTCATGTCAGTATGTGGTCTTTTCG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-4 inhibited Rv1738 promoter activity in a time-dependent manner, with an inhibition value of 61% at 96 hours and inhibited DevR–DevR interaction in vivo by ∼35%. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1668 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R7DevR16 (APT-5) | GTCTTGACTAGTTACGCC-CTGCCTTGGCTCGAAGGGGTGATGAGAAGTAGGCGGGAAGGCAG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-1, APT-2, APT-5, and APT-7 exhibited a maximum of ∼40% inhibition of Rv1738 promoter activity. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1669 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R7DevR28 (APT-6) | GTCTTGACTAGTTACGCC-CGAGGGGAAGGATGGGGTGGAGGGAGGTGGGGGAGGGTTGGTGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-6 inhibited Rv1738 promoter activity in a time-dependent manner, with an inhibition value of 66% at 96 hours and inhibited DevR–DevR interaction in vivo by ∼35%. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | 4.724 nM | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1670 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R7DevR29 (APT-7) | GTCTTGACTAGTTACGCC-CCCAAGAACCCGCTCGCCGTGGTGACGTCGATCATGCCTTTTGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-1, APT-2, APT-5, and APT-7 exhibited a maximum of ∼40% inhibition of Rv1738 promoter activity. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1671 | 34329020 | 2022 | Targeted mesoporous silica nanoparticles for improved inhibition of disinfectant resistant Listeria monocytogenes and lower environmental pollution | A15-HP-Am | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGATAGTA | 40 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115 and ATCC 7644) | Whole cell | BAC-encapsulated, aptamer-functionalized silica nanoparticles (AptBACNP) effectively killed only the target bacterium, L. monocytogenes, at lower doses, but not other bacteria. | Inhibition (MIC value) of BAC resistant Listeria strains with 8 times less the usual disinfectant dose. | N/A | N/A | N/A | Therapeutics | N/A | 5'-Amidation (NH₂) | MSNPs are slightly cytotoxic to erythrocytes and MCF-7 cells at concentrations more than 25 µg/ml. | N/A | N/A | N/A | N/A |
| ABdb_1672 | 35850461 | 2022 | Aptamer decorated emodin nanoparticles-assisted delivery of dermcidin-derived peptide DCD-1L: Photoactive bio-theragnostic agent for Enterococcus faecalis biofilm destruction | Aptamer | TAGGGAAGAGAAGGACATATGATACTGGCCTTGACACCCTGTTGTGGCTTGATGACAATAACATTGACTAGTACATGACCACTTGA | 86 | N/A | ssDNA | Enterococcus Faecalis | Whole cell | Apt@EmoNp-DCD-1L that binds E. faecalis, enabling targeted delivery of emodin nanoparticles and DCD-1L for anti-biofilm activity. | aPDT using Apt@EmoNp-DCD-1L caused ≈99.99% reduction of E. faecalis viability and strong biofilm disruption at sub-MIC concentrations (7.8 and 15.6 µM). | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1715 | 35448289 | 2022 | Aptamer-Based Fluorescence Detection and Selective Disinfection of Salmonella Typhimurium by Using Hollow Carbon Nitride Nanosphere | S. typhimurium Apt | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Develop an off-on fluorescence aptasensor for the detection of S. typhimurium and use HCNS-Cap for disinfection. | The fluorescence assay showed a linear range of 30 to 3 × 10(4) CFU/mL and a detection limit of 13 CFU/mL. The bactericidal efficiency of HCNS-Cap (95.0%) within 12 h was better than that of HCNS (85.1%) and Cap (72.9%). | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1746 | https://doi.org/10.1016/j.snb.2021.130879 | 2022 | Aptamer-conjugated magnetic Fe3O4@Au core-shell multifunctional nanoprobe: A three-in-one aptasensor for selective capture, sensitive SERS detection and efficient near-infrared light triggered photothermal therapy of Staphylococcus aureus | Apt | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CMCC 26003) | Whole cell | Developed an aptasensor based on Fe3O4@Au nanocomposites (NCs) for capture, SERS detection, and photothermal therapy (PTT) of S. aureus. | The detection limit is 25 cfu/mL, the cell capture efficiency (CCE) is as high as 68% and it has a high photothermal conversion efficiency of 39.28%. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | 5'-Thiolated | The cytotoxicity of Fe3O4@Au-Apt NCs to S. aureus is negligible. | The SERS intensity of S. aureus on the Fe3O4@Au-Apt NCs remains almost unchanged within 12 days. | N/A | N/A | N/A |
| ABdb_1747 | 37512948 | 2023 | Alpha-Gal Bound Aptamer and Vancomycin Synergistically Reduce Staphylococcus aureus Infection In Vivo | αSA31 | ATGATCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA | 49 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 33591) | Whole cell | αSA31 rescue α-1, 3-galactosyltransferase (−/−) knockout (GTKO) mice from induced MRSA sepsis. | 3.5-fold more (p < 0.05) pretreated MRSA were phagocytized when also treated with αSA31 and 7/12 mice treated with vancomycin plus αSA31 survived in-vivo. | N/A | N/A | N/A | Therapeutics | N/A | 5'-α-gal and 5'-Amidation (NH₂-(CH2)6) | No toxicity was observed, even at 10,000 µg/kg/day. | αSA31NH2 was significantly more stable (p < 0.01) in human serum, as no degradation was observed after 24 h at 37°C. | N/A | 5.222 h in Human serum. | N/A |
| ABdb_1769 | 37164985 | 2023 | Selecting antibacterial aptamers against the BamA protein in Pseudomonas aeruginosa by incorporating genetic algorithm to optimise computational screening method | Apt31 | ACCATCTGTGTAAGGGGTAAGGGGTGGGGGTGGGTACGTCT | 41 | N/A | ssDNA | Pseudomonas Aeruginosa | Outer membrane protein BamA (β-barrel assembly machinery A) | Selecting antibacterial aptamers against the BamA protein in Pseudomonas aeruginosa by incorporating a genetic algorithm to optimise the computational screening method. | Treatment of P. aeruginosa with 10 µM Apt31 for 2 h resulted in a significant reduction in CFU/mL and growth percentage. | N/A | N/A | N/A | Therapeutics | In-silico Method | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1773 | 37921634 | 2023 | Aptamer and DNAzyme-Functionalized Cu-MOF Hybrid Nanozymes for the Monitoring and Management of Bacteria-Infected Wounds | Aptamer | GGGAAAGGGAAAGGGAAAGGG-TTTTTT-ATCCAGACGTGACGCAGCATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTGTGGACACGGTGGCTTAGTA | 102 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | MRSA surface components | G-quadruplex/hemin DNAzyme-aptamer probes and tannic acid-chelated Au nanoparticle (Au-TA)-decorated Cu-based MOF nanosheets (termed GATC) with triple-enzyme activities were developed for visual detection and efficient antibacterial therapy. | ~99.7% MRSA inactivation at 3 μg/mL, with simultaneous colorimetric monitoring of infection. | N/A | N/A | N/A | Therapeutics | N/A | 5'-Thiolated | At 50 μg/mL GATC, the cells showed high viability (>90%), indicating negligible cytotoxicity and good cytocompatibility. The hemolysis rate of the GATC nanozyme was low (<5%). | N/A | N/A | N/A | N/A |
| ABdb_1829 | 37429429 | 2024 | Assessment of the growth inhibition and anti-biofilm activity of aptamer (PmA2G02) against Proteus mirabilis 1429T | PmA2G02 | ATTACTTACGCTATCTAAttttGCTGTAGGGGAGGAGGGTGGGTtttTTATCATCTGGTATGTTA | 65 | N/A | ssDNA | Proteus Mirabilis (1429T) | Biofilm | Inhibit biofilm formation, adhesion, and mobility, along with a reduction in biofilm-related genes, namely rsbA, fliC2 & fimD, in P. mirabilis. | Aptamer treatment resulted in a 50% reduction in biofilm thickness and a 2.29-fold and 1.34-fold decrease in mRNA expression of the fliC2 and fimD genes, respectively. | N/A | N/A | N/A | Therapeutics | Whole Cell-SELEX | N/A | Aptamer treatment did not significantly affect cell viability. | N/A | N/A | N/A | N/A |
| ABdb_1884 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-6 | GCTGCAATACTCATGGACAGCACGGCACGGGCTGTCGATCTCGAGGGAAACGGCACATGTGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Outer membrane protein BamA (β-barrel assembly machinery A) | Identify aptamers against Brucella and conjugate them to liposomes for selective recognition and significantly reduced bacterial invasion of host cells. | WS-6 significantly reduced Brucella invasion, as evidenced by a decrease in qPCR Ct from 22.34 to 20.64 (P < 0.05), confirming a reduced intracellular bacterial load. | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 16.23 ± 5.84 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | The aptamer demonstrated stable binding to the Brucella S2 vaccine across a temperature range of 16–50°C, with optimal binding observed between 16°C and 50°C and under neutral conditions (pH 7.6) in 2h. | Best Candidate | N/A | N/A |
| ABdb_1885 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-26 | GCTGCAATACTCATGGACAGCGGAACGCTGTCTCCTCATTCAATCTAGGAGTCTGCGTGAGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 20.33 ± 8.12 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1886 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-17 | GCTGCAATACTCATGGACAGGACAACGTCCTGTACCAGCGCTACGCCAGATCAGTTTTAGGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 17.11 ± 6.35 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1887 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-32 | GCTGCAATACTCATGGACAGGGGACTCAGGTCCCCGGGAGCGCAATGGTGGGGTTTTAATGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 13.08 ± 2.97 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1888 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-44 | GCTGCAATACTCATGGACAGGGACCTGTCCCTGGCCTCTTAGGGTAAAATTTTGCCACAAGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 15.03 ± 4.2 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1891 | 40855524 | 2025 | Inhibition of Enterotoxigenic Escherichia coli adhesion via aptamers prevents infection in IPEC-J2 cells | K88-Apt A04 | GGGAGCTCAGAATAAACGCTCAACCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTGTTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | K88 fimbriae protein | An aptamer was identified to effectively inhibit the adhesion of ETEC K88 to intestinal epithelial cell IPEC-J2 and reduce ETEC K88-induced cytotoxicity in IPEC-J2 cells in vitro. | K88-Apt A04 may more effectively displace ETEC K88 and induce less cytotoxicity than K88-Apt 37, as it resulted in lower TNF-α expression. | N/A | N/A | 34.51 ± 9.15 nM | Therapeutics | N/A | 5'-FAM Labeled | K88-Apt A04 indicated the lowest cytotoxicity (5.18%) at 100 nM | N/A | Best Candidate | N/A | N/A |
| ABdb_1892 | 40855524 | 2025 | Inhibition of Enterotoxigenic Escherichia coli adhesion via aptamers prevents infection in IPEC-J2 cells | K88-Apt 37 | GGAGACCGTACCATCTGTTCGTGGAAGCGCTTTGCTCGTCCATTAGCCTTGTGCTCGTGC | 60 | N/A | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | An aptamer was identified to effectively inhibit the adhesion of ETEC K88 to intestinal epithelial cell IPEC-J2 and reduce ETEC K88-induced cytotoxicity in IPEC-J2 cells in vitro. | K88-Apt A04 may more effectively displace ETEC K88 and induce less cytotoxicity than K88-Apt 37, as it resulted in lower TNF-α expression. | N/A | N/A | 21.68 ± 4.65 nM | Therapeutics | N/A | 5'-FAM Labeled | K88-Apt 37 revealed the lowest cytotoxicity (8.77%) at 50 nM. | N/A | N/A | N/A | N/A |
| ABdb_1914 | 40335784 | 2025 | A novel strategy for ultrasensitive detection and effective inactivation of Staphylococcus aureus based on Fe3O4-QCS-PEI-Cu-aptamer and ladder-branch HCR | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an integrated strategy based on Fe3O4-quaternary ammonium chitosan-polyetherimide-Cu-aptamer (Fe3O4-QCS-PEI-Cu-aptamer) and ladder-branch hybridization chain reaction (HCR) for the detection and inactivation of S. aureus. | The sensor demonstrated a limit of detection (LOD) of 3 CFU/mL for S. aureus and, under near-infrared (NIR) irradiation, achieved an antimicrobial efficiency of 99.946%. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | 3'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1955 | 17442275 | 2007 | Aptamer from whole-bacterium SELEX as new therapeutic reagent against virulent Mycobacterium tuberculosis | NK2 | N/A | N/A | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Membrane protein | Identify an aptamer that binds to and improves CD4+T cells & produces IFN-γ by blocking some membrane proteins of H37Rv, decreases the bacterial number, and prolongs the survival rate in the mouse model by inhibiting the invasion of M. tuberculosis into phagocytes and CD8+T cells. | Intracellular IFN-γ levels in CD3+CD4+ T cells increased from approximately 35% (without aptamer) to approximately 55% (with the NK2). The half-life of survival in mice was prolonged by 3 days with a single injection of NK2 aptamer treatment. | 10 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1964 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK2 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Significantly decreased macrophage invasion from 64.58% (without aptamers) to 33.02% (with 10th aptamer pool), and 26.01% (with NK2). | 10 | Flow Cytometry | 31 ± 4 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1965 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK1 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 48 ± 13 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1966 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK7 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 35 ± 9 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1967 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK8 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 107 ± 44 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1968 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK10 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 95 ± 28 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1969 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK20 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 55 ± 16 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2012 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-27 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2013 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-33 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | AT-33 inhibited α-toxin-induced upregulation of TNF-α and IL-17 in Jurkat T cells. Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2014 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-36 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | AT-36 inhibited α-toxin-induced upregulation of TNF-α and IL-17 in Jurkat T cells. Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2015 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-49 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2122 | 33367418 | 2021 | Photo-responsive functional gold nanocapsules for inactivation of community-acquired, highly virulent, multidrug-resistant MRSA | Aptamer | N/A | N/A | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) “superbug” (USA300) | Whole cell | Aptamers functionalization of Cur@mPEG-SH@GNRs for PTT and ROS. | Blocked biofilm formation and killed all of the trapped bacteria in 30 min during NIR stimulation. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2129 | 35765498 | 2022 | Single-stranded DNA aptamer-based rolling circle amplification as anti-chicken Salmonella bacteriostatic | Anti-Salmonella DNA aptamer | N/A | N/A | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) and Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify an aptamer targeting Salmonella in the form of RCA-p that could inhibit bacterial growth, multiplication, and viability. | Significant reduction in bacterial viability. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |