AptBacterialDB

Activity Role : Targeted Delivery/Therapeutics

Total records found: 18

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0540 258914722015Antibiotic loaded nanocapsules functionalized with aptamer gates for targeted destruction of pathogenSA20hpGCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT45N/AssDNAStaphylococcus aureus (S. aureus)Whole cellAptamer-gated nanocapsules for the specific targeting of vancomycin to bacteria for the controlled release of vancomycin.15-fold increase of efficacy for vancomycin with MIC of 0.420 μg/mL.N/AN/AN/ATargeted Delivery/TherapeuticsN/A5'-AlexaFluor 488 Labeled and 3'-(PEG)-AGGGCGC-BH1MICs of vancomycin-nanoparticles for S. epidermidis (control) were found to be 6.295 µg/mL.N/AN/AN/AN/A
ABdb_0552 254437902015Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterialsfmA12UGUAAUUCUGCCAUUCUUUUUGGGGCGGAAUACAGGAUGU405'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3'ssRNAStaphylococcus aureus (S. aureus)Staphylococcus aureus Protein A (SpA)Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing.fmA12-functionalized AgNPs resulted in specific S. aureus antimicrobial activity with only a 1.6 ± 1.0% survival of 12598 cells and 51.9 ± 2.0% survival of 10832 cells.8Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI)95 nM (by SPR) and 67.1 ± 6.1 nM (by BLI)Targeted Delivery/TherapeuticsSELEX2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂)N/A76% fmA12 survives in 10% mouse serum at 37°C over 24 h, and in 50% serum, 85.0% fmA12 survives after 5 h.N/A~52 h for fmA12.N/A
ABdb_0553 254437902015Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterialsfmF07AUACGCUGCUCACUAAAGUCGGGAGUACUCCAAUGUUUUC405'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3'ssRNAStaphylococcus aureus (S. aureus)Staphylococcus aureus Protein A (SpA)Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing.N/A8Bio-Layer Interferometry (BLI)38.9 ± 4.1 nM (by BLI)Targeted Delivery/TherapeuticsSELEX2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂)N/AN/ABest CandidateN/AN/A
ABdb_0554 254437902015Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterialsfmE09AUCUAGCAAGCACUUGCAAACAUUCGAUAACGGGGAUUC395'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3'ssRNAStaphylococcus aureus (S. aureus)Staphylococcus aureus Protein A (SpA)Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing.N/A8Bio-Layer Interferometry (BLI)418 ± 112 nM (by BLI)Targeted Delivery/TherapeuticsSELEX2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0555 254437902015Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterialsfmG12UGCCAAUGUAACUCAACACUCUUCAUUGAGCUGUCGGGCA405'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3'ssRNAStaphylococcus aureus (S. aureus)Staphylococcus aureus Protein A (SpA)Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing.N/A8Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI)475 nM (by SPR) and 220 ± 24 nM (by BLI)Targeted Delivery/TherapeuticsSELEX2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0556 254437902015Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterialsfmA12Δ3N/AN/A5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3'ssRNAStaphylococcus aureus (S. aureus)Staphylococcus aureus Protein A (SpA)Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing.N/A8Bio-Layer Interferometry (BLI)69.7 ± 3.5 nMTargeted Delivery/TherapeuticsSELEX2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0557 254437902015Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterialsfmA12Δ6N/AN/A5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3'ssRNAStaphylococcus aureus (S. aureus)Staphylococcus aureus Protein A (SpA)Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing.N/A8Bio-Layer Interferometry (BLI)63.1 ± 7.3 μMTargeted Delivery/TherapeuticsSELEX2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0558 254437902015Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterialsfmA12Δ9N/AN/A5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3'ssRNAStaphylococcus aureus (S. aureus)Staphylococcus aureus Protein A (SpA)Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing.N/A8Bio-Layer Interferometry (BLI)69.1 ± 16.7 nMTargeted Delivery/TherapeuticsSELEX2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0730 274242152016Gold nanoparticle-DNA aptamer conjugate-assisted delivery of antimicrobial peptide effectively eliminates intracellular Salmonella enterica serovar TyphimuriumAptHis (6H7)GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC40N/AssDNASalmonella typhimurium infected HeLa cellsS. typhimurium Whole cellHis-aptamer conjugated AuNP platform for the loading of His-tagged AMP (C-terminally hexahistidine-tagged A3-APO (A3-APOHis) AMPs) to eliminate intracellular S. Typhimurium cells.80% viability increase of infected HeLa cells and 100% survival rate of infected mice.N/AN/AN/ATargeted Delivery/TherapeuticsN/A3'-Thiolated (A10-Thiol) and Cyanine5 (Cy5) LabeledAuNP-Apt(His)-A3-APO(His) led to the increased viability of S. Typhimurium-infected HeLa cells.∼80% of A3-APOHis remained in serum after 48 h of incubation with AuNP-Apt(His)-A3-APO(His).N/AN/AN/A
ABdb_0760 https:doi.org10.1016j.carbon.2016.04.0142016Biodegradable graphene oxide and polyaptamer DNA hybrid hydrogels for implantable drug deliveryPolyaptamer (PA)ATCGGCTAGCACGTACAGAACTAAAAAAAAAAAA-GTCGGCTTAGCCTCAACCCCC-AAGGCAAAAAGGCAT70N/AssDNAEscherichia Coli (E. Coli) and Staphylococcus aureus (S. aureus)Kanamycin (Kan)Kan-loaded PA-GO (Kan/PA-GO) hybrid hydrogels for antibacterial effects.Significantly reduced the viability of E. coli and S. aureus to 24.2 ± 4.8% and 17.7 ± 0.7%, respectively.N/AN/AN/ATargeted Delivery/TherapeuticsN/A5'-PhosphateN/AN/AN/AN/AN/A
ABdb_0954 290516202017Antimicrobial peptide-loaded gold nanoparticle-DNA aptamer conjugates as highly effective antibacterial therapeutics against Vibrio vulnificusApt(His)GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC40N/AssDNAVibrio Vulnificus (MO6-24/O)V. vulnificus-infected HeLa cellsThe AuNP-AptHis conjugate delivers the HPA3P(His) peptide into host cells, inducing bacterial cell death by disrupting membrane integrity.Compared with that of buffer- or AuNP-AptHis-incubated cells, the number of viable V. vulnificus cells in the AuNP-AptHis-HPA3PHis-treated cells decreased by 90% in 10 min. All infected mice injected with AuNP-AptHis-HPA3PHis survived until 120 h.N/AN/AN/ATargeted Delivery/TherapeuticsN/A3'-Thiolated (A10-Thiol)HPA3PHis and AuNP-Apt(His)-HPA3P(His) did not exhibit cytotoxicity against HeLa cells and mouse erythrocytes up to 10 µM.N/AN/AN/AN/A
ABdb_1021 290985172018Influence of aptamer-targeted antibiofilm agents for treatment of Pseudomonas aeruginosa biofilmsPA-ap1 (F23)CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas Aeruginosa (ATCC 27853)Whole cellAptamer-ciprofloxacin-SWNTs complex for antibiofilm activity.90% inhibitory efficiency of complex aptamer-ciprofloxacin-SWNTs on biofilm formation.16Flow Cytometry17.27 ± 5.00 nMTargeted Delivery/TherapeuticsWhole Cell-SELEX5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1350 323331132020Inhibitory effects of aptamer targeted teicoplanin encapsulated PLGA nanoparticles for Staphylococcus aureus strainsSA20GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT45N/AssDNAStaphylococcus aureus (S. aureus) susceptible strains and MRSAWhole cellAptamer-PLGA nanoparticles (Apt-teicoplanin-PLGA NPs) for the delivery of teicoplanin antibiotic.MICs of teicoplanin decreased by 32- and 64-fold for susceptible strains and MRSA strains, respectively.N/AN/AN/ATargeted Delivery/TherapeuticsN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1540 346649412021Efficient Eradication of Bacterial Biofilms with Highly Specific Graphene-Based Nanocomposite SheetsS. Typhimurium aptamer (ST-NH2)TTTTTAAGCCCACTGGCGTTCGGACATCACAGCTCGTGCAGGTCGTGCCATG52N/AssDNASalmonella Typhimurium (S. Typhimurium) (CMCC 50115)Whole cellICG@GO-Apt nanosheets for eradication of biofilm associated with Salmonella Typhimurium.Shows an efficient biofilm elimination with an efficiency of greater than 99.99% in an abscess formation model.N/AN/AN/ATargeted Delivery/TherapeuticsN/A3'-Amidation (NH₂) or TAMRA, 5'-FAM Labeled or Amidation (NH₂)ICG@GO-Apt NSs had almost no cytotoxicity to HEK 293 cells, with more than 90% and lacked hemolytic activities.N/AN/AN/AN/A
ABdb_1548 343960092021DNA Aptamer-Conjugated Magnetic Graphene Oxide for Pathogenic Bacteria Aggregation: Selective and Enhanced Photothermal Therapy for Effective and Rapid KillingMRSA aptamerATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA755'-ATCCAGACGTGACGCAGC-N38-TGGACACGGTGGCTTAGTA-3'ssDNAMethicillin-resistant Staphylococcus aureus (MRSA)Whole cellApt@MGO nanoplatform for selective and rapid eradication of MRSA under NIR laser irradiation.Apt@MGO resulted in ∼78% MRSA and over >97% MRSA cell inactivation in dispersed and aggregated states, respectively, under 200 seconds of exposure to NIR irradiation (808 nm, 1.1 W cm–2).N/AN/AN/ATargeted Delivery/TherapeuticsN/A3'-Amidation (NH₂) and 5'-FITC LabeledThe aptamer itself did not cause any cell activation when incubated with MRSA cells, and also under no NIR laser illumination.N/AN/AN/AN/A
ABdb_1611 355737942022Aptamer-Targeted Drug Delivery for Staphylococcus aureus BiofilmSA31GCAATGGTACGGTACTTCC-TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA-CAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus) (DSM 20231)Whole cellAptamer-targeted liposomes encapsulating antibiotics for accumulation and delivery to eradicate S. aureus biofilm.SA31-modified liposomes fully eradicated all viable, culturable bacteria in all biofilm samples.N/AN/AN/ATargeted Delivery/TherapeuticsN/A3'-5-propargylamino-ddUTP-Cy5 or 3'-N3 modifiedN/ASA23 appeared more stable than the other aptamers in plasma over a 16-hour incubation period.N/AN/AN/A
ABdb_1672 358504612022Aptamer decorated emodin nanoparticles-assisted delivery of dermcidin-derived peptide DCD-1L: Photoactive bio-theragnostic agent for Enterococcus faecalis biofilm destructionAptamerTAGGGAAGAGAAGGACATATGATACTGGCCTTGACACCCTGTTGTGGCTTGATGACAATAACATTGACTAGTACATGACCACTTGA86N/AssDNAEnterococcus FaecalisWhole cellApt@EmoNp-DCD-1L that binds E. faecalis, enabling targeted delivery of emodin nanoparticles and DCD-1L for anti-biofilm activity.aPDT using Apt@EmoNp-DCD-1L caused ≈99.99% reduction of E. faecalis viability and strong biofilm disruption at sub-MIC concentrations (7.8 and 15.6 µM).N/AN/AN/ATargeted Delivery/TherapeuticsN/A5'-FAM Labeled and 5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_2122 333674182021Photo-responsive functional gold nanocapsules for inactivation of community-acquired, highly virulent, multidrug-resistant MRSAAptamerN/AN/A5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3'ssDNAMethicillin-resistant Staphylococcus aureus (MRSA) “superbug” (USA300)Whole cellAptamers functionalization of Cur@mPEG-SH@GNRs for PTT and ROS.Blocked biofilm formation and killed all of the trapped bacteria in 30 min during NIR stimulation.N/AN/AN/ATargeted Delivery/TherapeuticsN/A5'-ThiolatedN/AN/AN/AN/AN/A