Activity Role : Imaging

Total records found: 3

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0974	27951452	2017	(1→3)-β-D-glucan aptamers labeled with technetium-99m: Biodistribution and imaging in experimental models of bacterial and fungal infection	Seq6	CGACTGACGCCTCCAAGCCACACGTGTGAGAAGGGTGTTATCATGTATTTCGTGTTCCTTTCGTCATTCCTTTGTCTGCATGCATCGCTACGTG	94	N/A	ssDNA	Staphylococcus aureus (S. aureus) (ATCC 25923)	(1 → 3)-β-D-glucans	Radiolabeled aptamers were evaluated to identify infectious foci caused by bacterial cells.	The target/non-target ratios were 3.17 ± 0.22 for seq6 in S. aureus-infected animals.	N/A	N/A	0.303 ± 0.067 μM	Imaging	N/A	5'-Radiolabelled (99mTc labeled)	N/A	In vitro stability of seq6 aptamer labelled with 99mTc in the presence of 0.9% saline, plasma, and cysteine excess (molar ratio) was above 84.2 ± 2.9% in all cases at 24hrs.	N/A	N/A	N/A
ABdb_0975	28715874	2017	Detection of bacterial infection by a technetium-99m-labeled peptidoglycan aptamer	Antibac1	TCGCGCGAGTCGTCTGGGGACAGGGAGTGCGCTGCTCCCCCCGCACGTCCTCCC	54	N/A	ssDNA	Staphylococcus aureus (S. aureus) (ATCC 25923)	Peptidoglycan	Radiolabeled aptamers were evaluated for biodistribution studies and scintigraphic imaging in infection‐bearing mice.	Achieved a high target-to-non-target (T/NT) ratio of 4.7 ± 0.9 at 1.5 h and 4.6 ± 0.1 at 3.0 h in bacterial-infected models.	N/A	Binding Assay	0.170 ± 0.032 μM	Imaging	N/A	5'-Inverted Thymidine (5'-idT), 3'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (99mTc labeled)	N/A	Radiolabeling yields were superior to 90% and 99mTc‐Antibac1 was highly stable in the presence of saline, plasma, and cysteine up to 6 h.	N/A	Distribution half-life: 6.7 min and Elimination half-life: 41.3 min.	N/A
ABdb_1883	41431270	2025	Bioimaging with fluorescent nucleic-acid aptamers for the specific detection and quantification of Pseudomonas aeruginosa alone and in heterogeneous bacterial populations	F23	ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT	96	N/A	ssDNA	Pseudomonas Aeruginosa (ATCC 15692)	Whole cell	Develop a fluorescent aptamer for detecting Pseudomonas aeruginosa.	73.79% of live P. aeruginosa cells (3102/4204) were labeled by the Cy5‐F23 aptamer, compared to only 0.06% of live S. aureus (4/6767).	15	Flow Cytometry	17.27 ± 5.00 nM	Imaging	Whole Cell-SELEX	5'-Cyanine5 (Cy5) Labeled	N/A	The aptamer remains highly stable for 72 hours.	N/A	N/A	N/A