Activity Role : Diagnostic/Therapeutics

Total records found: 16

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0059 192656722009A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemiaAptamer 19TAGGGAATTCGTCACGGATCC-GGCGTCCACTCCCAGCCGCTCACTAGTTTCTGCGTGGGTGA-CTGCAGGTCGACGCATGCGCCG845'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3'ssDNAGram-negative BacteriaEndotoxin (Lipopolysaccharide (LPS))Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes.Survival rate of mice with LPS-induced sepsis increased from 10% to 75% after treatment.12Nitrocellulose Filter Binding AssayN/ADiagnostic/TherapeuticsSELEX5'-Radiolabelled ([γ-32P]-ATP-labeled)N/AN/ABest CandidateN/AN/A
ABdb_0060 192656722009A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemiaAptamer 18TAGGGAATTCGTCACGGATCC-GGCGTCCACTCCCAGCCGGTCACTAGTTTCTGCGTGGGTGA-CTGCAGGTCGACGCATGCGCCG845'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3'ssDNAGram-negative BacteriaEndotoxin (Lipopolysaccharide (LPS))Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes.N/A12Nitrocellulose Filter Binding AssayN/ADiagnostic/TherapeuticsSELEX5'-Radiolabelled ([γ-32P]-ATP-labeled)N/AN/AN/AN/AN/A
ABdb_0061 192656722009A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemiaAptamer 31TAGGGAATTCGTCACGGATCC-GGAGAATAACGACAAAAGGTAAACTACAGGCCCGGAGC-CTGCAGGTCGACGCATGCGCCG815'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3'ssDNAGram-negative BacteriaEndotoxin (Lipopolysaccharide (LPS))Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes.N/A12Nitrocellulose Filter Binding AssayN/ADiagnostic/TherapeuticsSELEX5'-Radiolabelled ([γ-32P]-ATP-labeled)N/AN/AN/AN/AN/A
ABdb_0062 192656722009A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemiaAptamer 14TAGGGAATTCGTCACGGATCC-AAAAGTCCTTGCAAGATAGACGCAGCCAGCCGGGTAGTC-CTGCAGGTCGACGCATGCGCCG825'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3'ssDNAGram-negative BacteriaEndotoxin (Lipopolysaccharide (LPS))Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes.N/A12Nitrocellulose Filter Binding AssayN/ADiagnostic/TherapeuticsSELEX5'-Radiolabelled ([γ-32P]-ATP-labeled)N/AN/AN/AN/AN/A
ABdb_0063 192656722009A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemiaAptamer 25TAGGGAATTCGTCACGGATCC-CTTGGCGTTACTTACCTGTACGTCGTAGAG-CTGCAGGTCGACGCATGCGCCG735'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3'ssDNAGram-negative BacteriaEndotoxin (Lipopolysaccharide (LPS))Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes.N/A12Nitrocellulose Filter Binding AssayN/ADiagnostic/TherapeuticsSELEX5'-Radiolabelled ([γ-32P]-ATP-labeled)N/AN/AN/AN/AN/A
ABdb_0064 192656722009A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemiaAptamer 43TAGGGAATTCGTCACGGATCC-TGAACGACGTCGCATTAGCGAGTAGGTTTACGAAGTAAGA-CTGCAGGTCGACGCATGCGCCG835'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3'ssDNAGram-negative BacteriaEndotoxin (Lipopolysaccharide (LPS))Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes.N/A12Nitrocellulose Filter Binding AssayN/ADiagnostic/TherapeuticsSELEX5'-Radiolabelled ([γ-32P]-ATP-labeled)N/AN/AN/AN/AN/A
ABdb_1026 299640282018Selection of DNA aptamers to Streptococcus pneumonia and fabrication of graphene oxide based fluorescent assayLyd-3TGACGAGCCCAAGTTACCT-GCCCCCGAACCATACCACACGATGCCCCGTACCCCAGCCACC-AGAATCTCCGCTGCCTACA805'-TGACGAGCCCAAGTTACCT-N42-AGAATCTCCGCTGCCTACA-3' (Library 1) and 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTTCACGGACCCCACT-3' (Library 2)ssDNAStreptococcus PneumoniaeWhole cellIdentify aptamers that bind to and develop a graphene oxide/aptamer-based label-free fluorescent assay to detect Streptococcus pneumoniae and inhibit biofilm formation.Show a detection limit of 15 cfu mL-1. Biofilm formation was reduced from 100% to 35.8% at a Lyd-3 concentration of 1 μM compared with the no-aptamer control.20Fluorescence Spectroscopy661.8 ± 111.3 nMDiagnostic/TherapeuticsWhole Cell-SELEXFAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_1027 299640282018Selection of DNA aptamers to Streptococcus pneumonia and fabrication of graphene oxide based fluorescent assayLyd-1AAGGGCTGGCTGGGATGGA-CCCTCCCGAAACGAGCTGTCTCTTAACGGAAGCTAATCTGCC-TCACTCCACGGACCCCACT805'-TGACGAGCCCAAGTTACCT-N42-AGAATCTCCGCTGCCTACA-3' (Library 1) and 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTTCACGGACCCCACT-3' (Library 2)ssDNAStreptococcus PneumoniaeWhole cellIdentify aptamers that bind to and develop a graphene oxide/aptamer-based label-free fluorescent assay to detect Streptococcus pneumoniae and inhibit biofilm formation.At 100 nM of Lyd-1, biofilm formation decreased to 90.8%.20Fluorescence Spectroscopy844.7 ± 123.6 nMDiagnostic/TherapeuticsWhole Cell-SELEXFAM LabeledN/AN/AN/AN/AN/A
ABdb_1028 299640282018Selection of DNA aptamers to Streptococcus pneumonia and fabrication of graphene oxide based fluorescent assayLyd-2TGACGAGCCCAAGTTACCT-CACCCGCCTGGCAAAAAACACCACGACATTTTTCTCACCCCC-AGAATCTCCGCTGCCTACA805'-TGACGAGCCCAAGTTACCT-N42-AGAATCTCCGCTGCCTACA-3' (Library 1) and 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTTCACGGACCCCACT-3' (Library 2)ssDNAStreptococcus PneumoniaeWhole cellIdentify aptamers that bind to and develop a graphene oxide/aptamer-based label-free fluorescent assay to detect Streptococcus pneumoniae and inhibit biofilm formation.At 100 nM of Lyd-2, biofilm formation decreased to 92.6%.20Fluorescence Spectroscopy1984.8 ± 347.5 nMDiagnostic/TherapeuticsWhole Cell-SELEXFAM LabeledN/AN/AN/AN/AN/A
ABdb_1503 343474272021Aptamer-Functionalized DNA-Silver Nanocluster Nanofilm for Visual Detection and Elimination of BacteriaApt-GTCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACGGGTGGGGTGGGGTGGGG80N/AssDNAStaphylococcus aureus (S. aureus)Whole cellDNA-templated silver nanoclusters (N4-AgNC/Apt-G) for the visual detection and effective elimination of bacteria.After treatment with 5 μM N4-AgNCs/Apt-G, a significantly reduced number of colonies was observed. At the lowest inhibitory concentration of 6.25 μM, the number of colonies decreased by only 4-fold, which is significantly less than the 7-fold reduction observed at 5 μM. Obtained recovery rates ranging from 88% to 115% of S. aureus.N/AN/AN/ADiagnostic/TherapeuticsN/AN/AN4-AgNCs/Apt-G was found to be nontoxic at low concentrations, and cell viability was more than 80% at a concentration of 6.25 μM.N/AN/AN/AN/A
ABdb_1612 356162772022Targeted inhibition of methicillin-resistant Staphylococcus aureus biofilm formation by a graphene oxide-loaded aptamer/berberine bifunctional complexAptamer 1GGGAGCTCAGAATAAACGCTCAATACTATCGCGGAGACAGCGCGGGAGGCACCGGGGAGATCCGGGCCTCATGTCGAA785'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3'ssDNAMethicillin-resistant Staphylococcus aureus (MRSA)Penicillin binding protein 2a (PBP2a)Identify a PBP2a-targeted aptamer in conjunction with GO for the delivery of berberine to treat chronic infections caused by MRSA biofilms.The linear range was 10^3–10^7 CFU/mL, and the detection limit for the fluorescent assay was 800 CFU/mL. The inhibition rate peaked at 92.8% after treatment with the GO-berberine/aptamer 1 (containing 200 nM aptamer 1) complex.14Fluorescence Spectroscopy82.97 ± 8.86 nMDiagnostic/TherapeuticsSELEXFAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_1613 356162772022Targeted inhibition of methicillin-resistant Staphylococcus aureus biofilm formation by a graphene oxide-loaded aptamer/berberine bifunctional complexAptamer 2GGGAGCTCAGAATAAACGCTCAAGGCACACAGGACTATACAGTGTTGCAGTGTTGCTGGATCCGGGCCTCATGTCGAA785'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3'ssDNAMethicillin-resistant Staphylococcus aureus (MRSA)Penicillin binding protein 2a (PBP2a)Identify a PBP2a-targeted aptamer in conjunction with GO for the delivery of berberine to treat chronic infections caused by MRSA biofilms.N/A14Fluorescence Spectroscopy152.92 ± 29.26 nMDiagnostic/TherapeuticsSELEXFAM LabeledN/AN/AN/AN/AN/A
ABdb_1628 358424602022DNA-aptamer-nanographene oxide as a targeted bio-theragnostic system in antimicrobial photodynamic therapy against Porphyromonas gingivalisAptamerTATGCCAGCATTTCGCCAACGGTGGTCATACAGTGTGAA39N/AssDNAPorphyromonas GingivalisWhole cellDNA-aptamer-NGO, a targeted bio-theragnostic system against P. gingivalis for antimicrobial photodynamic therapy (aPDT).MIC of DNA-aptamer-NGO was 62.5 nM, and MBC was 125 nM. aPDT using 1/2 × and 1/4 × MBC of DNA-aptamer-NGO plus irradiation of the diode laser light (1 min) has a significantly anti-biofilm effect; percentage of apoptosis cells treated with DNA-aptamer-NGO at 1/2 × and 1/4 × MIC plus diode laser were 13.9% and 12.7%; and 1/2 × MIC of DNA-aptamer-NGO, resulted in 40.3% inactivation of metabolic activity compared to 1/4 × MBC of DNA-aptamer-NGO, where only 22.2% inactivation.N/AN/AN/ADiagnostic/TherapeuticsN/AFAM LabeledAt high concentrations of DNA-aptamer-NGO, incubated for 24 hours with human red blood cells, the percentage did not exceed 5%. Also, at different concentrations, the mean percentage of HGF cell viability ranges from 95.2% to 87.6%.N/AN/AN/AN/A
ABdb_1715 354482892022Aptamer-Based Fluorescence Detection and Selective Disinfection of Salmonella Typhimurium by Using Hollow Carbon Nitride NanosphereS. typhimurium AptTATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028)Whole cellDevelop an off-on fluorescence aptasensor for the detection of S. typhimurium and use HCNS-Cap for disinfection.The fluorescence assay showed a linear range of 30 to 3 × 10(4) CFU/mL and a detection limit of 13 CFU/mL. The bactericidal efficiency of HCNS-Cap (95.0%) within 12 h was better than that of HCNS (85.1%) and Cap (72.9%).N/AN/AN/ADiagnostic/TherapeuticsN/ACyanine5 (Cy5) LabeledN/AN/AN/AN/AN/A
ABdb_1746 https://doi.org/10.1016/j.snb.2021.1308792022Aptamer-conjugated magnetic Fe3O4@Au core-shell multifunctional nanoprobe: A three-in-one aptasensor for selective capture, sensitive SERS detection and efficient near-infrared light triggered photothermal therapy of Staphylococcus aureusAptGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus) (CMCC 26003)Whole cellDeveloped an aptasensor based on Fe3O4@Au nanocomposites (NCs) for capture, SERS detection, and photothermal therapy (PTT) of S. aureus.The detection limit is 25 cfu/mL, the cell capture efficiency (CCE) is as high as 68% and it has a high photothermal conversion efficiency of 39.28%.N/AN/AN/ADiagnostic/TherapeuticsN/A5'-ThiolatedThe cytotoxicity of Fe3O4@Au-Apt NCs to S. aureus is negligible.The SERS intensity of S. aureus on the Fe3O4@Au-Apt NCs remains almost unchanged within 12 days.N/AN/AN/A
ABdb_1914 403357842025A novel strategy for ultrasensitive detection and effective inactivation of Staphylococcus aureus based on Fe3O4-QCS-PEI-Cu-aptamer and ladder-branch HCRAptamerGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus)Whole cellDeveloped an integrated strategy based on Fe3O4-quaternary ammonium chitosan-polyetherimide-Cu-aptamer (Fe3O4-QCS-PEI-Cu-aptamer) and ladder-branch hybridization chain reaction (HCR) for the detection and inactivation of S. aureus.The sensor demonstrated a limit of detection (LOD) of 3 CFU/mL for S. aureus and, under near-infrared (NIR) irradiation, achieved an antimicrobial efficiency of 99.946%.N/AN/AN/ADiagnostic/TherapeuticsN/A3'-COOH (Carboxylated)N/AN/AN/AN/AN/A