Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 788
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0001 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | B12b10_65 | GACGTCTTCGAATCCCCATACTGTGGCATTGGCTCAGGACGGTCTGGAGGATGGGGCTTGACGTG | 65 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | 200 ± 20 (against short SEB peptide) and 420 nM (Full length SEB protein) | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0002 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | B12b10 | TCAGCTGGACGTCTTCGAAT-CCCCATACTGTGGCATTGGCTCAGGACGGTCTGGAGGATGGGGCTTGACGTCATCATCTG-TGTCAGGAGCTCGAATTCCC | 100 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0003 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | B12a10 | TCAGCTGGACGTCTTCGAAT-TACCAAGGTGTACGAGCGGCATTGGCTTAGGATGGTCTAGGAGAACGCCTTGTTCACGGG-TGTCAGGAGCTCGAATTCCC | 100 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0004 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | B12d10 | TCAGCTGGACGTCTTCGAAT-GGGCATTGGCTAGGACGGTCTAGCAGGAGAAGATGTTAAGTGTGCCTTAGTCAGAGAGTG-TGTCAGGAGCTCGAATTCCC | 100 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0005 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | B12e7 | TCAGCTGGACGTCTTCGAAT-GGGTATAGTGTCTGGCATTGGCGAGGATGGTCTCAAACGCTAAACCCAATCTGTATAACA-TGTCAGGAGCTCGAATTCCC | 100 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0006 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | A8c3 | TCAGCTGGACGTCTTCGAAT-CGTGGGCATCGGGCTGCATGAATGGCATTGGCGAGGAGGGTGTGTTTGTAGGCAGCACCT-TGTCAGGAGCTCGAATTCCC | 100 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0007 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | AE11a5 | TCAGCTGGACGTCTTCGAAT-ACCCGTACAGTCCTATGTTGGCATCCTCACTTGTGGCATTGGCAAGGATGGTCTTCTAG-TGTCAGGAGCTCGAATTCCC | 99 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0008 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | A8g1 | TCAGCTGGACGTCTTCGAAT-GCTCGACAGGGCACCACCGCCTCGGCATTGGCTAGGTTGGTCTCTTTGGCGGGGTTGCGC-TGTCAGGAGCTCGAATTCCC | 100 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0042 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | hemag1P | AGCAGCACAGAGGTCAGATG-TAGCCCTTCAACATAGTAATATCTCTGCATTCTGTGTG-CCTATGCGTGCTACCGTGAA | 78 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | The number of aptamer molecules binding to each cell (on average, ∼164 ± 47 aptamer molecules per cell). | 8 | Flow Cytometry | 13 ± 3 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0043 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | hemag1 | TAGCCCTTCAACATAGTAATATCTCTGCATTCTGTGATG | 39 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0044 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | mag1 | TGAGCCCCACTAAAGTTGCAATCATGTCGTCAGCTTTGGG | 40 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0045 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | hemag3 | CGTCGCGGCATATTTCCAGTGGAACGGTTACGATATGTTG | 40 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0046 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | mag1P | AGCAGCACAGAGGTCAGATG-TGAGCCCCAGTAAAGTTGCAATCATGTCGTCAGCTTTGGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0047 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | hemag3P | AGCAGCACAGAGGTCAGATG-TCGTCGCGGCATATTTCCAGTGGAACGGTTACGATATGTTG-CCTATGCGTGCTACCGTGAA | 81 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0048 | 18214875 | 2008 | Detection and titer estimation of Escherichia coli using aptamer-functionalized single-walled carbon-nanotube field-effect transistors | Aptamer | GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU | 81 | N/A | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Develop aptamer-functionalized SWNT-FET sensors for the detection of E. coli. | The SWNT-FETs showed a conductance decrease of more than 50% after binding with E. coli in less than 20 min. | N/A | N/A | N/A | Detection | SELEX | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0049 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA20 | GCAATGGTACGGTACTTCC-GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Identify aptamers that bind to S. aureus strains, including 8325-4, 196, and 04018, and develop a probe to distinguish them from S. epidermidis, Streptococcus, and E. coli. | EC50 = 70.86 ± 39.22nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0050 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA23 | GCAATGGTACGGTACTTCC-GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50 = 61.50 ± 22.43nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0051 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA31 | GCAATGGTACGGTACTTCC-TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50=82.86 ± 33.20nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0052 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA34 | GCAATGGTACGGTACTTCC-CACAGTCACTCAGACGGCCGCTATTGTTGCCAGATTGCCTTTGGC-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50 =72.42 ± 35.23nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0053 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA43 | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50 = 210.70 ± 135.91nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0065 | 19284297 | 2009 | The selection and application of ssDNA aptamers against MPT64 protein in Mycobacterium tuberculosis | M64CA (aptamers 20, 34, 41, 46, and 50 ) | GGGAGCTCAGAATAAACGCTCAA-TTCGGGAATGATTATCAAATTTATGCCCTCTGAT-TTCGACATGAGGCCCGGATC | 77 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Identify an aptamer that binds to MPT64, and an aptamer-MPT64 was designed to detect M. tuberculosis by measuring MPT64 protein levels in culture filtrates. | The sandwich assay scheme based on the aptamer-protein complex had a high sensitivity (86.3%) and specificity (88.5%). | 12 | N/A | N/A | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0066 | 19284297 | 2009 | The selection and application of ssDNA aptamers against MPT64 protein in Mycobacterium tuberculosis | Aptamer 11 (named M64RA) | GGGAGCTCAGAATAAACGCTCAA-TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Identify an aptamer that binds to MPT64, and an aptamer-MPT64 was designed to detect M. tuberculosis by measuring MPT64 protein levels in culture filtrates. | The sandwich assay scheme based on the aptamer-protein complex had a high sensitivity (86.3%) and specificity (88.5%). | 12 | N/A | N/A | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0083 | https://doi.org/10.4028/www.scientific.net/KEM.439-440.1456 | 2010 | In Vitro Selection of Oligonucleotide Acid Aptamers against Pathogenic Vibrio Alginolyticus by SELEX | Sequence A | GCCCAATCGCCGTCTTCTACA-TGTGCGTGTGTCAGCGAATATCACCTAGAGGTCGG-AGTGCCAACGCCCTCCTGAT | 76 | 5'-GCCCAATCGCCGTCTTCTACA-N35-AGTGCCAACGCCCTCCTGAT-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify a high-affinity aptamer against Vibrio alginolyticus. | Bind to different sites of the V. alginolyticus surface. | 15 | N/A | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0084 | https://doi.org/10.4028/www.scientific.net/KEM.439-440.1456 | 2010 | In Vitro Selection of Oligonucleotide Acid Aptamers against Pathogenic Vibrio Alginolyticus by SELEX | Sequence B | CCCAATCGCCGTCTTCTACA-TGTATGCTGCCGAGGTTGGCCTCTTAGTCAGCTGAGAGTGCCAACGCCCTCCTGATATGCCCAATCGCCGTCTTCTACATTGTGGTCGTGGGAATGCATTCATCCGTTGCCGG-AGTGCCAACGCCCTCC | 149 | 5'-GCCCAATCGCCGTCTTCTACA-N35-AGTGCCAACGCCCTCCTGAT-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify a high-affinity aptamer against Vibrio alginolyticus. | Bind to different sites of the V. alginolyticus surface. | 15 | N/A | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0086 | 21627466 | 2011 | Aptamer selection for the detection of Escherichia coli K88 | Aptamer 19 | CGTACGGTCGACGCTAGC-GGCGACCCCCGGGCTACCAGACAATGTACGCAGCAAGAGTGACGGTCGTACCTCGGAGTC-CACGTGGAGCTCGGATCC | 96 | 5'-CGTACGGTCGACGCTAGC-N60-CACGTGGAGCTCGGATCC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | K88 fimbriae protein | Identify aptamers that bind to and detect the K88 fimbriae protein of E.coli K88 surface protein. | N/A | 11 | Fluorescence Spectroscopy | 44 ± 7 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0087 | 21627466 | 2011 | Aptamer selection for the detection of Escherichia coli K88 | Aptamer 31 | CGTACGGTCGACGCTAGC-ACACTCTTTTGCTCGTGTTTTTGCCTGTTACATAAAATGAATCAGTGGATGTTTCCTTCT-CACGTGGAGCTCGGATCC | 96 | 5'-CGTACGGTCGACGCTAGC-N60-CACGTGGAGCTCGGATCC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | K88 fimbriae protein | Identify aptamers that bind to and detect the K88 fimbriae protein of E.coli K88 surface protein. | N/A | 11 | Fluorescence Spectroscopy | 36 ± 8 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0088 | 21627466 | 2011 | Aptamer selection for the detection of Escherichia coli K88 | Aptamer 7 | CGTACGGTCGACGCTAGC-GGCGGCCGTGAAATTTGCCAAATGCCGTCTTGGCTTTCGCCCAATGTATCCTGGGTGTTC-CACGTGGAGCTCGGATCC | 96 | 5'-CGTACGGTCGACGCTAGC-N60-CACGTGGAGCTCGGATCC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | K88 fimbriae protein | Identify aptamers that bind to and detect the K88 fimbriae protein of E.coli K88 surface protein. | N/A | 11 | Fluorescence Spectroscopy | 43 ± 6 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0089 | 21627466 | 2011 | Aptamer selection for the detection of Escherichia coli K88 | Aptamer 37 | CGTACGGTCGACGCTAGC-GGAGACCGTACCATCTGTTCGTGGAAGCGCTTTGCTCGTCCATTAGCCTTGTGCTCGTGC-CACGTGGAGCTCGGATCC | 96 | 5'-CGTACGGTCGACGCTAGC-N60-CACGTGGAGCTCGGATCC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | K88 fimbriae protein | Identify aptamers that bind to and detect the K88 fimbriae protein of E.coli K88 surface protein. | Fluorescence intensity of other bacteria (ETEC K99, S. aureus, E. coli TOP10) is lower than that of ETEC K88. | 11 | Fluorescence Spectroscopy | 25 ± 4 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0090 | 22166202 | 2011 | In vitro selection of Escherichia coli O157:H7-specific RNA aptamer | Two Arm ( from clone I-1) | GGGUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAUAGAUAGUAA | 64 | 5'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3' | ssRNA | Escherichia Coli (E. Coli) O157:H7(ATCC 43895) | Whole cell | Identify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli. | Specifically bound to the lipopolysaccharide, which includes the O antigen from the O157:H7 strain, but not to the LPS from the K12 strain. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | ~110 nM | Detection | Subtractive SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3' | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0091 | 22166202 | 2011 | In vitro selection of Escherichia coli O157:H7-specific RNA aptamer | Clone I-1 | GGGAUACCAGCUUAUUCAAUU-UGAUUCCAUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAU-AGAUAGUAAGUGCAAUCU | 99 | 5'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3' | ssRNA | Escherichia Coli (E. Coli) O157:H7(ATCC 43895) | Whole cell | Identify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli. | Bound to the E. coli O157:H7 strain 2.8-fold better than the control. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Subtractive SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3' | N/A | N/A | N/A | N/A | N/A |
| ABdb_0092 | 22166202 | 2011 | In vitro selection of Escherichia coli O157:H7-specific RNA aptamer | Clone III-2 | GGGAUACCAGCUUAUUCAAUU-CGCACUGUUUUGCCCAGCCGUGUGAAAUUGAUUAGACGUUUUGUAUGCGAUUUCGCCUUG-AGAUAGUAAGUGCAAUCU | 99 | 5'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3' | ssRNA | Escherichia Coli (E. Coli) O157:H7(ATCC 43895) | Whole cell | Identify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli. | Bound to the E. coli O157:H7 strain 2.3-fold better than the control. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Subtractive SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3' | N/A | N/A | N/A | N/A | N/A |
| ABdb_0093 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A24P | AGCAGCACAGAGGTCAGATG-GGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGG-CCTATGCGTGCTACCGTGAA | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 20A24P forms a branched structure with high affinity for the target cell mixture (gated fluorescence intensity above library of 64%). | 20 | Flow Cytometry | 9.1 ± 0.8 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0094 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 15A3P | TTCACGGTAGCACGCATAGG-GACAGCAAGCCCAAGCTGGGTGTGCAAGGTGAGGAGTGGG-CATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | Show a gated fluorescence above the background of 48%. | 20 | Flow Cytometry | 9.6 ± 0.3 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0095 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A1 | CAGAACGCACCCGCACACCTCCATCACTCGCATGCACCCC | 40 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 72% gated fluorescence intensity above the library. | 20 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0096 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A1P | TTCACGGTAGCACGCATAGG-CAGAACGCACCCGCACACCTCCATCACTCGCATGCACCCC-CATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 72% gated fluorescence intensity above the library. | 20 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0097 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A8 | CCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCC | 40 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 20A8 binding to the target GAS cells yielded 72% gated fluorescence above background. | 20 | Flow Cytometry | 4 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0098 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A8P | AGCAGCACAGAGGTCAGATG-CCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCC-CCTATGCGTGCTACCGTGAA | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 20A8P binding to the target GAS cells yielded 68% gated fluorescence above background. | 20 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0099 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A9 | CACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGG | 39 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 65% gated fluorescence intensity above the library. | 20 | Flow Cytometry | 9 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0100 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A9P | AGCAGCACAGAGGTCAGATG-CACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGG-CCTATGCGTGCTACCGTGAA | 79 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 66% gated fluorescence intensity above the library. | 20 | Flow Cytometry | 9.1 ± 0.6 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0101 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A12P | TTCACGGTAGCACGCATAGG-GCCCGACACTCGTCCACCCGATACCTCTCATGTGTCCC-CATCTGACCTCTGTGCTGCT | 78 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | N/A | 20 | Flow Cytometry | 25 ± 3 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0102 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A14P | AGCAGCACAGAGGTCAGATG-GGCATGGGGAAGAGAAAGCGGGATAACTTCGTTACCGGGC-CCTATGCGTGCTACCGTGAA | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | N/A | 20 | Flow Cytometry | 17 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0105 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F23 | ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | F23 showed great specificity to P. aeruginosa and no cross-reactivity with other bacterial species. | 15 | Flow Cytometry | 17.27 ± 5.00 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0106 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F12 | ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTTGCTTTTGTTCGCTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0107 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F8 | ATACCAGCTTATTCAATT-CCGTGGCGTTCTGTTTGTTCGTTGTTTTTTGGTTTTTCCTTCTTTTTTTGTTTTTGGTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0108 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F1 | ATACCAGCTTATTCAATT-GGCGCGCGTTGTGTGGTTTGGCTTTTTTCGTTTGTTTTTCTTGGGTGCTTGTCTTCGTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0109 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F20 | ATACCAGCTTATTCAATT-CCCTCGCCGTACGTTCTCCGTTTTGTCAGGTGTTGTTTTTTCCGTCCTCTTCTCGTGTGC-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0110 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F4 | ATACCAGCTTATTCAATT-CCACCGATTCCCTTCGATCGTATTCGTGTTGCTCTCGTGTTGTAATGCGTCCTGTGCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0111 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F6 | ATACCAGCTTATTCAATT-GGCACCGGCTTGTCTGTTTCTCTTGGTTCGCCGCTGGACTTTGTTAGCTCCCTCCGCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0112 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F7 | ATACCAGCTTATTCAATT-CCCCACAACCTGACCTTTCTATTCCGTTCCCCTTTTTTCAGCTTCTTTCCGGCCTCTGTT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0113 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F18 | ATACCAGCTTATTCAATT-CCACCACCGGGTTGTTTTTCCTGCAGGCCTTTATCGTTTTCCGCGCTCGATTCGGTCATG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0114 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F5 | ATACCAGCTTATTCAATT-CCACCGTGCTTTATATTACCCGTCCACCCTTCGGTCTTTCTCCCCGTGTCGCTCCGCTTT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0115 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F21 | ATACCAGCTTATTCAATT-CCACCGGGCCTCGTATTCGTACTGTTTGATTCTTTGGCTTTGTAGCGGACGTACTGGGTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0116 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F2 | ATACCAGCTTATTCAATT-CCCCCGCGCCCGTCTCTCTCAATCTCCGCATTCTTTAGTTCTCATCCTCCCTGTGTGTTT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0117 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F24 | ATACCAGCTTATTCAATT-GACACCCGGAGTAATTCCGTTTTAAGCGTCTTTCATGTGTTCCCTTTCGTTCCTCCCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0118 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F15 | ATACCAGCTTATTCAATT-CCCAAGGTCGAGTTCCTAGTCTTACCGTATTTCACTTTCCTGGTTCTTACCTCCCCCTCA-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0119 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F22 | ATACCAGCTTATTCAATT-CGGCGCGAGTCGACTGCACAGGGTCCTATTGCTTATGGTCATGGTTTCGTTTCATCCTCG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0120 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F16 | ATACCAGCTTATTCAATT-CCCGCGATATGACCATCCAGCTGCTCCTCTGTTATTGTTGGTTTTCCTGTTTTCCTTTGT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0121 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F17 | ATACCAGCTTATTCAATT-CCCCAGTGCTCAGCTTCTCCTCCGTCTCATTCTTCTGTAGGATCGTTCTGTTTTGGTACT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | 57.63 ± 11.64 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0122 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F10 | ATACCAGCTTATTCAATT-CCCACCGTCCTCGTGCTTAGTCTTTATGTTTCGTCCTTTTCTTTCTTCGTTCTGTCGCCT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0123 | 21875107 | 2011 | Identification of environmental reservoirs of nontyphoidal salmonellosis: aptamer-assisted bioconcentration and subsequent detection of salmonella typhimurium by quantitative polymerase chain reaction | Sal aptamer | CTCACCAGGAGATTACAACATGG-TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG-AGCTCAGACCAAAAGTGACCATC | 86 | 5'-CTCACCAGGAGATTACAACATGG-N40-AGCTCAGACCAAAAGTGACCATC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Detection of Salmonella Typhimurium by serovar-specific DNA aptamer-conjugated dynabeads in water samples. | Sediments from the selected sampling locations also exhibit Salmonella Typhimurium in the range of 3.37 × 10(4) to 3.08 × 10(9) cfu/100 g. | N/A | N/A | N/A | Detection | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0124 | 22310030 | 2012 | Development of RNA aptamers for detection of Salmonella Enteritidis | S25 | GGGUUCACUGCAGACUUGACGAAGCUU-GAGAGAUGCCCCCUGAUGTGCAUUCUUGUUGUGUUGCGGC-AAUGGAUCCACAUCTACGAAUUC | 90 | 5'-GGGUUCACUGCAGACUUGACGAAGCUU-N40-AAUGGAUCCACAUCUACGAAUUC-3' | ssRNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify an aptamer that binds to the outer membrane protein C and specifically recognizes S. enteritidis without any cross-reactivity to other Salmonella serovars. | Fluorescence intensity of S. Enteritidis enhanced as the concentration of the aptamer S25 increased from 5 to 30 μg. | 10 | Flow Cytometry | N/A | Detection | Magnetic Bead (MB)-based SELEX | 5'-Fluoro-labeled with Fluorescein-maleimide | N/A | N/A | N/A | N/A | N/A |
| ABdb_0125 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A3P | ATAGGAGTCACGACGACCAGAA-TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | Showed a high binding affinity of 76% for V. parahemolyticus and a low apparent binding affinity of 4% for other bacteria. | 9 | Flow Cytometry | 16.88 ± 1.92 | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0126 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A1 | TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG | 40 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A1 was 64%. | 9 | Flow Cytometry | 22.92 ± 4.72 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0127 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A1P | ATAGGAGTCACGACGACCAGAA-TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A1P was 67%. | 9 | Flow Cytometry | 21.45 ± 2.62 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0128 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A3 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A3 was 75%. | 9 | Flow Cytometry | 24.03 ± 5.18 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0129 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A17P | ATAGGAGTCACGACGACCAGAA-AGGCCGGCCCCTCTGAACTAGATGCAGGGGAGGCGAGCGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0130 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A18P | ATAGGAGTCACGACGACCAGAA-GCGGGCAGCTCCACCGGTAGGCTCCGAGTCATCACGGTCG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A18P was 62%. | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0131 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A21P | ATAGGAGTCACGACGACCAGAA-TTTTGACGAAGTCAGTGCGTCGAAGCGCAAGCATTACAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0132 | 22438927 | 2012 | A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B | APT(SEB1) | GGTATTGAGGGTCGCATC-CACTGGTCGTTGTTGTCTGTTGTCTGTTATGTTGTTTCGT-GATGGCTCTAACTCTCCTCT | 78 | 5'-GGTATTGAGGGTCGCATC-N40-GATGGCTCTAACTCTCCTCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to SEB and quantification of all of the SEs in S. aureus contaminated food. | Have an affinity and high selectivity for SEB. | 14 | N/A | N/A | Detection | SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0133 | 22438927 | 2012 | A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B | APT(SEB2) | GGTATTGAGGGTCGCATC-CCGTAGTGTGTTCTTATTCGTGTCTGTGTGTGTTCTGTCG-GATGGCTCTAACTCTCCTCT | 78 | 5'-GGTATTGAGGGTCGCATC-N40-GATGGCTCTAACTCTCCTCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to SEB and quantification of all of the SEs in S. aureus contaminated food. | N/A | 14 | N/A | N/A | Detection | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0139 | 22154169 | 2012 | Label-free detection of Staphylococcus aureus in skin using real-time potentiometric biosensors based on carbon nanotubes and aptamers | NH2-Aptamer | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A single-walled carbon nanotube (SWCNT) functionalized with an aptamer-based biosensor to detect Staphylococcus aureus in real-time. | With covalent functionalization, the minimum concentration detected was 8 × 10(2) CFU/mL; with the non-covalent approach, it was 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0140 | 22154169 | 2012 | Label-free detection of Staphylococcus aureus in skin using real-time potentiometric biosensors based on carbon nanotubes and aptamers | Pyr-Aptamer | GCAATGGTACGGTACTTCCGCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTATCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A single-walled carbon nanotube (SWCNT) functionalized with an aptamer-based biosensor to detect Staphylococcus aureus in real-time. | With covalent functionalization, the minimum concentration detected was 8 × 10(2) CFU/mL; with the non-covalent approach, it was 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | 3'-C3-Pyr | N/A | N/A | N/A | N/A | N/A |
| ABdb_0157 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-1 | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTG | 46 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0158 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-2 | ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCAT | 40 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0159 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-3 | GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGC | 39 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | Successfully detect S. typhimurium down to 600 CFU/mL (equivalent to 18 live cells in 30 μL of assay volume) and distinguish it from other Salmonella species, including S. enteritidis and S. choleraesuis. | 12 | Flow Cytometry | 25 nM | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0160 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-4 | CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0161 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-5 | GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTCGCATAGGTAGTCCAGAAGCC | 61 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0162 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-6 | CTCCTCTGACTGTAACCACG-GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGCC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0163 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-7 | CTCCTCTGACTGTAACCACG-GTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGTC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0164 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-8 | CTCCTCTGACTGTAACCACG-GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0165 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-9 | CTCCTCTGACTGTAACCACG-ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCATC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0166 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | E06 | TGATCCGGGCCTCATGTCGAACCCACACCCCACAACCACCCAGCCCCAGCCCGCTATTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0167 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | F04 | TGATCCGGGCCTCATGTCGAACACAACACCCAGCCAACGACCACAACTCCAACTCATTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0168 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | C10 | TGATCCGGGCCTCATGTCGAAACCACAACCCAACAACAAGAACCACAAAGAGCCCCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0169 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | B06 | TGATCCGGGCCTCATGTCGAACACACACAGAACCACAACCACTAAACACGAGGGCCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0170 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | B10 | GATCCGGGCCTCATGTCGAACACCCCCCAACTAAAACAACAAAACACCACCGCCATTGAGCGTTTATTCTGAGCTCCCA | 79 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | Digoxigenin-B10 bound to the Salmonella O8 target with high specificity, producing a clear fluorescent signal within 1.5–2 h. | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | 32.04 nM | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0171 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | C04 | TGATCCGGGCCTCATGTCGAACCAACAAGGCAGAAAGAAACCGACAAACCGCACTGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0172 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | F05 | TGATCCGGGCCTCATGTCGAACCAACAAGGCAGAAAGAAACCGACAAACCGCACTGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0173 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | B05 | TGATCCGGGCCTCATGTCGAACCGAACGACTCAAAGATCAAGCCAAGCCACGCCCGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0174 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | G05 | TGATCCGGGCCTCATGTCGAACCAACCCAACACCAAAGAGACCACCACCACACGAGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | 175.9 nM | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0175 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | D04 | TGATCCGGGCCTCATGTCGAACACGAGCCACCAACGCACCAAAACCCGTCCTCCACTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0176 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | E04 | TGATCCGGGCCTCATGTCGAAGGCACGCGCACCAAAACACAAACTCCCCCCGCACCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0177 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | G06 | TGATCCGGGCCTCATGTCGAAGGGCCACCTAACCACCTCTGCCAATACCCCCCGCGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0178 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | C05 | TGATCCGGGCCTCATGTCGAAGGGAAGTCATGGCATGGATGCGCTCCCCGCCCACCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0179 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | C06 | TGATCCGGGCCTCATGTCGAAGGGAAGTCATGGCATGGATGCGCTCCCCGCCCACCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0180 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | H05 | TGATCCGGGCCTCATGTCGAACGGCGCAGTGACACGGTAGGGAGTCGTGCCGCGGCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0181 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | H06 | TGGGAGCTCAGAATAAACGCTCAAGGTGGGCGGGCGGCGTTGCTGTTCTTTTGCTGGTGTTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0182 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | F06 | TGGGAGCTCAGAATAAACGCTCAAGAGGCGGCCTGTTCGCTTGTTGTGGGTCCGCTTGGTTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0183 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | A05 | TGGGAGCTCAGAATAAACGCTCAAGGGCACTGGGTGGTGATGTTTTGTTTGTCTGGCGGTTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0184 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | D06 | TGGGAGCTCAGAATAAACGCTCAAGGGGGGGGTGGAGGGGTATGCAGTTTCGGTGGCCGTTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0220 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C4 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-ACGGGCGTGGGGGCAATGCCTGCTTGTAGGCTTCCCCTGTGCGCG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | C4 showed strong specific binding to S. Typhimurium, and the increase in the fluorescence intensity of C4 was less than 30% against E. coli and S. aureus. | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0221 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C1 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGTCGGAGCCAGGATGCGAGGTCTGTAGGTCTGCGGGCGG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0222 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C2 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-ACGGCGGGCGAGTTGACGGCGTAATCGTGCTGCCGCGTG-GGTGGATCCATATTCCTACTCG | 99 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0223 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C3 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGGGCGTGGCTCAGAGTGGGGGTCGGTCAGTCTTGTGCGCG-GGTGGATCCATATTCCTACTCG | 102 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0224 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C5 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGGACGCCTGCGTGGCTGAGGCTTCGGTCTGCGCCG-GGTGGATCCATATTCCTACTCG | 101 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0225 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C6 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CGTGCGGCGGGCAGGATGGGATGCTGTAGGTCTGCGGGCGCGCG-GGTGGATCCATATTCCTACTCG | 104 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0226 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C7 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CGTGCGGAGCCAGGATGGGAGGTCTGTAGGTCTGCGGGGCGCG-GGTGGATCCATATTCCTACTCG | 103 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0227 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C8 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGGGACGGGTACCGGGCGTGTGGCGTGCCTGCCGCG-GGTGGATCCATATTCCTACTCG | 99 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0228 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C9 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-ACGTGCGGGCCGGATGGGAGCTCTGTAGGTTGCGGGCGCGG-GGTGGATCCATATTCCTACTCG | 101 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0229 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | CA1/SA-1 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGGGGGCCAGGATGCGA-GGTGGATCCATATTCCTACTCG | 82 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0230 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | CA2/SA-2 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GGTCTGTAGGTCTGCGGCGCGCG-GGTGGATCCATATTCCTACTCG | 83 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0231 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | CA3/SA-3 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGGGGGCCAGGATGCGAGGTCTGTAGGTCTGCGGCGCGCG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0238 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA1 | ATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA | 75 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA1 and DTMRSA3 showed the best specificity for MRSA. | 17 | Flow Cytometry | 1.6 ± 0.5 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0239 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA2 | ATCCAGAGTGACGCAGCA-CGACACGTTAGGTTGGTTAGGTTGGTTAGTTTCTTG-TGGACACGGTGGCTTA | 70 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA2 and DTMRSA4 bound to all three types of clinical bacterial strains. | 17 | Flow Cytometry | 2.0 ± 0.6 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0240 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA3 | ATCCAGAGTGACGCAGCA-GTAGATGGTTTGGTTGGTGTGGTTTCCTACTGATGTTGGG-TGGACACGGTGGCTTAGTA | 77 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA1 and DTMRSA3 showed the best specificity for MRSA. | 17 | Flow Cytometry | 1.3 ± 0.5 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0241 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA4 | ATCCAGAGTGACGCAGCA-TTATGGGGTGTGGTGGGGGGTTAATGCGTTGGTTATCCG-TGTGGACACGGTGGCTTA | 75 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA2 and DTMRSA4 bound to all three types of clinical bacterial strains. | 17 | Flow Cytometry | 9.5 ± 2 × 10(1) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0273 | 23676911 | 2013 | In vitro selection of RNA aptamer specific to Salmonella typhimurium | Clone I-2 | GGGAGAGCGGAAGCGUGCUGGG-UAGUGUGAGAGCCGUGAGUGAAAGGCCGCGACAAAGAUCGGA-CAUAACCCAGAGGUCGAUGGUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 15277) | OmpC protein | Identify an RNase-resistant RNA aptamer that binds to the OmpC protein of S. Typhimurium. | Bound only to Sal.Typhimurium, but not to S. aureus, E. coli O157:H7 and to that does not express the OmpC protein. | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 20.27 ± 4.372 nM | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0274 | 23676911 | 2013 | In vitro selection of RNA aptamer specific to Salmonella typhimurium | Clone I-2 Truncated 43-mer | GUGAGAGCCGUGAGUGAAAGGCCGCGACAAAGAUCGGAC | 39 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 15277) | OmpC protein | Identify an RNase-resistant RNA aptamer that binds to the OmpC protein of S. Typhimurium. | Bound only to Sal.Typhimurium, but not to S. aureus, E. coli O157:H7 and to that does not express the OmpC protein. | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 27.64 ± 4.784 nM | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0275 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #2 | GGGAGAGCGGAAGCGUGCUGGGCC-GGGAGUUUUGAUACGGCUUCAUGCAGUAAUGUUUUUAU-CAUAACCCAGAGGUCGAUGGAUCCCC | 88 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | The level of binding of #2 RNA aptamer to S. aureus was 1.6-fold higher than that of the control aptamer. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0276 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #10 | GGGAGAGCGGAAGCGUGCUGGGCC-GUUAAUACGGUGUCUUUUUCGGUCGUGUAUAAAACGGAAU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0277 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #14 | GGGAGAGCGGAAGCGUGCUGGGCC-UAGGACAGUUCGUCCUCAUUACAUCGCCGCCUAACACAUC-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0278 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #16 | GGGAGAGCGGAAGCGUGCUGGGCC-UUAGAAGUAGCCUGCUACGCAUGGUCGACUCAAGAAUCG-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0279 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #18 | GGGAGAGCGGAAGCGUGCUGGGCC-UCCGAACAGCGGAAGGUGGUUCGAAGUUGGGGCUUUGGA-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0280 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #21 | GGGAGAGCGGAAGCGUGCUGGGCC-AGUCUGACACGUAGACAGUUCUAUUACUUACGUCGAGA-CAUAACCCAGAGGUCGAUGGAUCCCC | 88 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0281 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #23 | GGGAGAGCGGAAGCGUGCUGGGCC-ACAGUGUUCUAAUGCGACAAUGGAGUCUGUGGCAAAGUGU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0282 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #24 | GGGAGAGCGGAAGCGUGCUGGGCC-UCUCAGGCCGACAUUCUGAGAACGCGAGGCGUAUUGAAG-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0283 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #26 | GGGAGAGCGGAAGCGUGCUGGGCC-UUCAAGUAGGGGCGGUUUACUAUCUGGAUCUUGUAGUUAU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0284 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #07 | GGGAGAGCGGAAGCGUGCUGGGCC-ACUUGGGGACGACGAGUAGAUAGUAAGGUGGAGACCUGGU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0285 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #06 | GGGAGAGCGGAAGCGUGCUGGGCC-UAUGACAUAAGGUGGGCUGGGAAGCUAGAGCAUGUAAGG-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0286 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #05 | GGGAGAGCGGAAGCGUGCUGGGCC-GUGAAGAAAAAGGGGCGGAUUGGGUAGUAGGGAGGAGAUC-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0287 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #04 | GGGAGAGCGGAAGCGUGCUGGGCC-AGGAUAGGGGAUGAAGAAAAAAAGAAGGGUGCCGUGGCGC-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0288 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone G1 | GGGAGAGCGGAAGCGUGCUGGGCC-UCCGAACAGCGGAAGGUGGUUCGAAGUUGGGGCUUUGGA-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0289 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA101 | ATTACTTACGCTATCTAAttt-GGGGGGTGGGTTGTTTGGGATGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0290 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA102 | ATTACTTACGCTATCTAAttt-GGGGGGGGAACATGTTTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | 3.5 nM (for B4) and 1.4 nM (for DL1d-A6) | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0291 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA103 | ATTACTTACGCTATCTAAttt-GGGGCGGGACTTATTTGGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0292 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA104 | ATTACTTACGCTATCTAAttt-GGGGGTGGGTGCTTTTGTGGTGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0293 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA105 | ATTACTTACGCTATCTAAttt-TAGGGGTGGGTTCAATTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0294 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA106 | ATTACTTACGCTATCTAAttt-GGGGGGCGGGTATTAATGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0295 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA107 | ATTACTTACGCTATCTAAttt-GTTTTCGTGGGGGGGTGGGTGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0296 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA108 | ATTACTTACGCTATCTAAttt-GCACTAAAGGGGAGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0297 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA109 | ATTACTTACGCTATCTAAttt-TTGCTTTAGGGGAGGTTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | 7.7 nM (for B4) and 4.1 nM (for DL1d-A6) | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0298 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA110 | ATTACTTACGCTATCTAAttt-TCGCTGATGGGGAGGAGGGTGGGT-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0299 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA111 | ATTACTTACGCTATCTAAttt-GCCCGATGGGGGTGGCGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0300 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G02 | ATTACTTACGCTATCTAAttt-TTGCTGTAGGGGAGGAGGGTGGGT-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Displayed the highest specificity, exhibiting a 36% higher specificity index than that of the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0301 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G19 | ATTACTTACGCTATCTAAttt-TTTTTCGGGGGGTGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0302 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G14 | ATTACTTACGCTATCTAAttt-TTGCTTTAGAGGAGGCGGGTGGAG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0303 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G11 | ATTACTTACGCTATCTAAttt-TCGGTGATGGGGAGGAGGCGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0304 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G03 | ATTACTTACGCTATCTAAttt-GTTTTATGGGGGTGGCGTGTGGCG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0305 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G06 | ATTACTTACGCTATCTAAttt-TCGCTGATGGGGAGGAGCGTGGGT-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0306 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G10 | ATTACTTACGCTATCTAAttt-TTACTTTTGGGGGGGCGGGTGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0307 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G02 | ATTACTTACGCTATCTAAttt-GCACGTTTGGGGAGGTTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0308 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G09 | ATTACTTACGCTATCTAAttt-TTTTTCGAGGGGAGATTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0309 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G20 | ATTACTTACGCTATCTAAttt-GCGCGAGTGGGGGGGTGGGTGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0310 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G04 | ATTACTTACGCTATCTAAttt-GCCCGCGTCGGGGGGTGGGGGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0311 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G01 | ATTACTTACGCTATCTAAttt-TCGCTATGGGGGTGGCGGCTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0312 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G17 | ATTACTTACGCTATCTAAttt-TAGCTTTAGGGGTCGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0313 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G08 | ATTACTTACGCTATCTAAttt-GAGCTTTAGAGGTGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0314 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G04 | ATTACTTACGCTATCTAAttt-TTCCTTGGGGAGTGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0315 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G06 | ATTACTTACGCTATCTAAttt-GTTTTCGGGGGCTGGTGGTTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0316 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G09 | ATTACTTACGCTATCTAAttt-TGGCTCGGGGGGTGTTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0317 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E1 | GCAATGGTACGGTACTTCC-ACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 12.4 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0318 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E2 | GCAATGGTACGGTACTTCC-CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 25.2 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0319 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E10 | GCAATGGTACGGTACTTCC-GTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGG-CAAAAGTGCACGCTACTTTGCTAA | 90 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 14.2 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0320 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E12 | GCAATGGTACGGTACTTCC-GCGAGGGCCAACGGTGGTTACGTCGCTACGGCGCTACTGGTTGAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 16.8 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0322 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S 1 | ATAGGAGTCACGACGACCAGAA-CGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGGCAGGG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Identify an aptamer targeted against Shigella dysenteriae and develop a sandwich-type fluorescent bioassay for quantification. | Obtained linear range between 10(2)-10(7) cfu/mL of S. dysenteriae, and the limit of detection was 50 cfu/mL | 8 | Fluorescence Binding Assay | 23.47 ± 2.48 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled and Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0323 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S12 | ATAGGAGTCACGACGACCAGAA-CCTGGCGGGTCCCGGGGTAAACGGCACAAACGATAAAGAA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0324 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S2 | ATAGGAGTCACGACGACCAGAA-AAGATGACACTTGGCAGCCGCCTCGAGTGTCCTACACGCA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0325 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S8 | ATAGGAGTCACGACGACCAGAA-GCCAGATGAGGCCGGCAGGGCCCAAGTGTTGCTCGGGCTA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0326 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S21 | ATAGGAGTCACGACGACCAGAA-TGCACGGGACAAGAGTACACGCCGATTGCCAGGCACAGTG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | 75.49 ± 3.74 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0327 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S10 | ATAGGAGTCACGACGACCAGAA-GGGGAAGCCGATCAGGCCAATCATTGAGGGTGAACTAGCT-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0328 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S19 | ATAGGAGTCACGACGACCAGAA-TTATCGGCTGGCAAAACTGCGGCTGGAGCTCACAACTAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0329 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S13 | ATAGGAGTCACGACGACCAGAA-TCAGCGAGGGCCAATTAGAAGGGTACTCATGTCTGTGGAC-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0330 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S24 | ATAGGAGTCACGACGACCAGAA-CCAGGCGGAATGTGTCTTCGTTTTGCGAGTGTTAAGGGCG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0331 | 23494620 | 2013 | Selection of DNA aptamers for capture and detection of Salmonella Typhimurium using a whole-cell SELEX approach in conjunction with cell sorting | S8-7 | GTATACGTATTACCTGCAGC-CTGATGTGTGGGTAGGTGTCGTTGATTTCTTCTGGTGGGG-CGATATCTCGGAGATCTTGC | 80 | 5'-GTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (Strain S913) | Whole cell | Identifying aptamers selected by whole-cell SELEX and developing a qPCR-based capture-detection platform for Salmonella Typhimurium. | N/A | 10 | Flow Cytometry | 1.73±0.54 μM | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0332 | 23494620 | 2013 | Selection of DNA aptamers for capture and detection of Salmonella Typhimurium using a whole-cell SELEX approach in conjunction with cell sorting | S8-46 | GTATACGTATTACCTGCAGC-CTTGGGCGGTTGGTGTGATGGGCTTTTTTCGTTGGGCCGG-CGATATCTCGGAGATCTTGC | 80 | 5'-GTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (Strain S913) | Whole cell | Identifying aptamers selected by whole-cell SELEX and developing a qPCR-based capture-detection platform for Salmonella Typhimurium. | Achieved a Lower Limit of Detection (LOD) of 10(2)-10(3) CFU in a 290-μl sample, and the mean capture efficiency ranged from 3.6% to 12.6%. | 10 | Flow Cytometry | 0.74±0.20 μM | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0356 | 25185503 | 2014 | Selection of peptidoglycan-specific aptamers for bacterial cells identification | Antibac1 | TCGCGCGAGTCGTCTG-GGGACAGGGAGTGCGCTGCTCCCC-CCGCATCGTCCTCCC | 55 | 5'-TCGCGCGAGTCGTCTG-N24-CCGCATCGTCCTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) and Escherichia Coli (E. Coli) TOP10 | Peptidoglycan | Identify aptamers that bind to the peptidoglycan of bacterial cells. | High binding affinity for S. aureus, as the radioactivity of Antibac1 was 28 times higher than the negative control. | 5 | Saturation Binding Assay | 0.415 + 0.047 μM | Detection | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0357 | 25185503 | 2014 | Selection of peptidoglycan-specific aptamers for bacterial cells identification | Antibac2 | TCGCGCGAGTCGTCTG-GGGGACTAGAGGACTTGTGCGGCC-CCGCATCGTCCTCCC | 55 | 5'-TCGCGCGAGTCGTCTG-N24-CCGCATCGTCCTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) and Escherichia Coli (E. Coli) TOP10 | Peptidoglycan | Identify aptamers that bind to the peptidoglycan of bacterial cells. | High binding affinity for S. aureus, as the radioactivity of Antibac2 was 22 times higher than the negative control. | 5 | Saturation Binding Assay | 1.261 + 0.280 μM | Detection | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0358 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-27 | ACGGCTCGCACTCTCTGATTT-GGCATAGCTGCCGGGAGGGGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | The binding signal of EcA5-27 for E. coli NSM59 was notably higher (~ 1.5-fold) than for laboratory strains of E. coli, and 8.5- and 56-fold to additional uropathogenic isolates compared with laboratory strains. | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 110 nM | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0359 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-01 | ACGGCTCGCACTCTCTGATTT-CGGCACCCCGTCGCTATGTTGACC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0360 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-02 | ACGGCTCGCACTCTCTGATTT-GGGGAGGTGGCGACCGCTTCTCAG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0361 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-03 | ACGGCTCGCACTCTCTGATTT-GGGGTCAGATATTAAACCGTGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0362 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-04 | ACGGCTCGCACTCTCTGATTT-GGGAGAGGGAGTGGTCTGGGAGAG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0363 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-05 | ACGGCTCGCACTCTCTGATTT-GCGGGCTTCGACACAGTGGGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0364 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-06 | ACGGCTCGCACTCTCTGATTT-GGGAGGGGCGGCGAAGGAGTGGCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0365 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-07 | ACGGCTCGCACTCTCTGATTT-GGAAGCGGTGGGGATCGTGTGTGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0366 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-08 | ACGGCTCGCACTCTCTGATTT-GGGAGCAAATCCGGAATGTGGGGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0367 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-09 | ACGGCTCGCACTCTCTGATTT-GGCGGAGGGGTTCGGGGTTGGCGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0368 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-10 | ACGGCTCGCACTCTCTGATTT-GGCGGGGCGTGGGGGATGTGTGTG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0369 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-11 | ACGGCTCGCACTCTCTGATTT-GGAATGCGAAGTGTGGCCTAGGGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0370 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-12 | ACGGCTCGCACTCTCTGATTT-GGGCGGGGGGGGATTCCGAGGCGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0371 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-13 | ACGGCTCGCACTCTCTGATTT-GGGGGGGTGGCATTTTGGGGTGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0372 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-14 | ACGGCTCGCACTCTCTGATTT-GCGGGGAAAGAGAAGGAAGCGTCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0373 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-15 | ACGGCTCGCACTCTCTGATTT-GGGCCCGAGTGGCGGTAGTTTCAG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0374 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-16 | ACGGCTCGCACTCTCTGATTT-GGGGGGTGGTGAAGGCCTGGGGGA-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0375 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-17 | ACGGCTCGCACTCTCTGATTT-GGGCCGGAGGGGCGCCTGCACCCA-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0376 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-18 | ACGGCTCGCACTCTCTGATTT-GGGGTTAGGCGAGGGGGGTGGGTG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0377 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-19 | ACGGCTCGCACTCTCTGATTT-CGGACGGTAGGGAAGGGGGGGGCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0378 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-20 | ACGGCTCGCACTCTCTGATTT-GGCGAGGCAGGGTGCGGGGGCCCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0379 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-21 | ACGGCTCGCACTCTCTGATTT-GCGTGTGGTGGGTGAGGGGTCTGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0380 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-22 | ACGGCTCGCACTCTCTGATTT-GGGGATAGCAGGACAATGAGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0381 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-23 | ACGGCTCGCACTCTCTGATTT-GGCCGCGTGTGTGTCCGACTGGTG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0382 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-24 | ACGGCTCGCACTCTCTGATTT-GGGCGAGGAGAGAGGCGGAGGGCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0383 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-25 | ACGGCTCGCACTCTCTGATTT-GCCGTGGTGTGTGTGATGGTCGGT-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0384 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-26 | ACGGCTCGCACTCTCTGATTT-GGCTTGGCTCCTCACGGGGGGTGA-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0385 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-28 | ACGGCTCGCACTCTCTGATTT-GGAGGGGTTGACCATGACCGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0386 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-29 | ACGGCTCGCACTCTCTGATTT-GGGGGAAGGGCCAATGGATTGTGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0387 | 24417693 | 2014 | Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum | WKB-14 | GCTGCAATACTCATGGACAG-GTTGCGAAAGACAACGAATGCTTTGCCTGCCATAATTTGC-GTCTGGAGTACGACCCTGAA | 80 | 5'-GCTGCAATACTCATGGACAG-N40-GTCTGGAGTACGACCCTGAA-3' | ssDNA | Mycoplasma Bovis (M. Bovis) | P48 protein | Indirect competitive enzyme-linked aptamer assay (ic-ELAA) for the serological detection of M. bovis. | With a PI cutoff value of 40%, the ic-ELAA had higher positive detection rates than two commercial indirect ELISA. | 11 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 15.61 ± 2.36 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0388 | 24417693 | 2014 | Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum | WKB-3 | GCTGCAATACTCATGGACAG-GCCGCGACCATACAACGCAAACAACACGCCTGTACGCTTG-GTCTGGAGTACGACCCTGAA | 80 | 5'-GCTGCAATACTCATGGACAG-N40-GTCTGGAGTACGACCCTGAA-3' | ssDNA | Mycoplasma Bovis (M. Bovis) | P48 protein | Indirect competitive enzyme-linked aptamer assay (ic-ELAA) for the serological detection of M. bovis. | N/A | 11 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 32.81 ± 7.75 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0389 | 24417693 | 2014 | Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum | WKB-51 | GCTGCAATACTCATGGACAG-GTGCGAAGCGCCTCCACTGTACATCCACTCCTTCTGCC-GTCTGGAGTACGACCCTGAA | 78 | 5'-GCTGCAATACTCATGGACAG-N40-GTCTGGAGTACGACCCTGAA-3' | ssDNA | Mycoplasma Bovis (M. Bovis) | P48 protein | Indirect competitive enzyme-linked aptamer assay (ic-ELAA) for the serological detection of M. bovis. | N/A | 11 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 20.81 ± 4.48 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0390 | 24417693 | 2014 | Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum | WKB-49 | GCTGCAATACTCATGGACAG-GCAGACGTCAGAACAATACCAATACTAATCCTTGGACCGC-GTCTGGAGTACGACCCTGAA | 80 | 5'-GCTGCAATACTCATGGACAG-N40-GTCTGGAGTACGACCCTGAA-3' | ssDNA | Mycoplasma Bovis (M. Bovis) | P48 protein | Indirect competitive enzyme-linked aptamer assay (ic-ELAA) for the serological detection of M. bovis. | N/A | 11 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0391 | 24417693 | 2014 | Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum | WKB-20 | GCTGCAATACTCATGGACAG-CAACGAACAATACATTATCTACATCACATTGCCCCGCGTG-GTCTGGAGTACGACCCTGAA | 80 | 5'-GCTGCAATACTCATGGACAG-N40-GTCTGGAGTACGACCCTGAA-3' | ssDNA | Mycoplasma Bovis (M. Bovis) | P48 protein | Indirect competitive enzyme-linked aptamer assay (ic-ELAA) for the serological detection of M. bovis. | N/A | 11 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0392 | 24417693 | 2014 | Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum | WKB-48 | GCTGCAATACTCATGGACAG-GCACGACATAACAACACTTATAGACTACTTCCCCCCTCGC-GTCTGGAGTACGACCCTGAA | 80 | 5'-GCTGCAATACTCATGGACAG-N40-GTCTGGAGTACGACCCTGAA-3' | ssDNA | Mycoplasma Bovis (M. Bovis) | P48 protein | Indirect competitive enzyme-linked aptamer assay (ic-ELAA) for the serological detection of M. bovis. | N/A | 11 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0393 | 24417693 | 2014 | Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum | WKB-37 | GCTGCAATACTCATGGACAG-GTCCAAACACTATCTCTTCACTTGCTGTTGTTCCCGTGGC-GTCTGGAGTACGACCCTGAA | 80 | 5'-GCTGCAATACTCATGGACAG-N40-GTCTGGAGTACGACCCTGAA-3' | ssDNA | Mycoplasma Bovis (M. Bovis) | P48 protein | Indirect competitive enzyme-linked aptamer assay (ic-ELAA) for the serological detection of M. bovis. | N/A | 11 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0394 | 24417693 | 2014 | Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum | WKB-82 | GCTGCAATACTCATGGACAG-GCACAACACATTAGACTTTGCTCTTCGGTCCCTCCGGCT-GTCTGGAGTACGACCCTGAA | 79 | 5'-GCTGCAATACTCATGGACAG-N40-GTCTGGAGTACGACCCTGAA-3' | ssDNA | Mycoplasma Bovis (M. Bovis) | P48 protein | Indirect competitive enzyme-linked aptamer assay (ic-ELAA) for the serological detection of M. bovis. | N/A | 11 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0395 | 24417693 | 2014 | Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum | WKB-53 | GCTGCAATACTCATGGACAG-GCTACCACCAAACATACGCACTCGTCGTCTGCCCTATGTG-GTCTGGAGTACGACCCTGAA | 80 | 5'-GCTGCAATACTCATGGACAG-N40-GTCTGGAGTACGACCCTGAA-3' | ssDNA | Mycoplasma Bovis (M. Bovis) | P48 protein | Indirect competitive enzyme-linked aptamer assay (ic-ELAA) for the serological detection of M. bovis. | N/A | 11 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0396 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G6-25 | GGATCTGGTTAGTGAAGAGGGGGGAGGGGGGGTTGGGCTGTGGGGCGGTTAGTCGT | 56 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 6 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0397 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G11-5 | ATACATCTTAAGTCTCGTGGGGGGAGGGGGGGTTGGTGGGCTTT | 44 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | β-structure of membrane associated protein | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | Colorimetric assay demonstrated detection of S. mutans cells at a concentration range of 1 × 10(5)-10(8) CFU/mL. | 11 | Flow Cytometry | 33 nM | Detection | In Silico Maturation (ISM) | 5'-Thiolated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0398 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G11-6 | ATACTATCGCATTCCTTCCGAGGGGGGAGGGGGGGGTGGGGGTCGGT | 47 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | β-structure of membrane associated protein | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | Showed the highest binding signals to S. mutans with a 16-fold increase over SMa#3-6-P1. | 11 | Flow Cytometry | 33 nM | Detection | In Silico Maturation (ISM) | 5'-Fluorescein Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0399 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#3-6-P1 | ATACCAGCTTATTCAATTGGGGGGAGGGGGGGTTGGGCTGTGGGGCGGTTAGCCGC | 56 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 3 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0400 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G11-20 | CTACGTCTAGATTCCAGTCGAGGGGGGAGGGGGGGTTTTGGATCGGT | 47 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 11 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0401 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G10-11 | CAACCTGCTTATCTAAGGGGGGGAGGGGGGGTTGTGGGTAGGT | 43 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 10 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0402 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G2-1 | CTAGCAGTTCATTCAATAGGGGGGACGGGGGGTTAGGCTAGACTATGTCTAATCA | 55 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 2 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0403 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G5-5 | ATACACGTAAGTACCATTGGGCGGGGGGGGTGTTGTTTTCTACTATGTGCAATCG | 55 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 5 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0404 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G11-8 | ACACCACTTAATTCCATGCGAGGGGGGAGGGGGGGTTCGGGGACGGC | 47 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 11 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0405 | 24813997 | 2014 | Selection of RNA aptamers against the M. tuberculosis EsxG protein using surface plasmon resonance-based SELEX | G43 | UAAUACGACUCACUAUAGGGAGACAAGACUAGACGCUCAA-AAUAGGAACUUAGAACAACCCUCUCCCUCAUGUAGCGAACCCGAACCAGG-UUCGACAUGAGACUCACAACAGUUCCCUUUAGUGAGGGUUAAUU | 134 | N/A | ssRNA | Mycobacterium Tuberculosis (H37Rv) | EsxG protein | Identify aptamers against EsxG over its homologue EsxA. | The affinity of aptamer G43 to EsxG was about ten times higher than the affinity of aptamer G78 and also showed no significant binding to EsxA. | 5 | Surface Plasmon Resonance (SPR) | 8.04 ± 1.9 nM | Detection | SPR based SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0406 | 24813997 | 2014 | Selection of RNA aptamers against the M. tuberculosis EsxG protein using surface plasmon resonance-based SELEX | G78 | UAAUACGACUCACUAUAGGGAGACAAGACUAGACGCUCAA-GCGUUUAAACGUUGCACCGUCGUUGACGGGACCGCUUGAGACAUUCGCUC-UUCGACAUGAGACUCACAACAGUUCCCUUUAGUGAGGGUUAAUU | 134 | N/A | ssRNA | Mycobacterium Tuberculosis (H37Rv) | EsxG protein | Identify aptamers against EsxG over its homologue EsxA. | G78 showed some binding to EsxA, though a significantly lower binding signal was observed (p < 0.01) when compared to that of EsxG. | 5 | Surface Plasmon Resonance (SPR) | 78.85 ± 9.4 nM | Detection | SPR based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0407 | 24813997 | 2014 | Selection of RNA aptamers against the M. tuberculosis EsxG protein using surface plasmon resonance-based SELEX | G31 | UAAUACGACUCACUAUAGGGAGACAAGACUAGACGCUCAA-UAACGACUCACCAACACAUCGACUAAUUUCCCUAAAUGACUUAACUGAAU-UUCGACAUGAGACUCACAACAGUUCCCUUUAGUGAGGGUUAAUU | 134 | N/A | ssRNA | Mycobacterium Tuberculosis (H37Rv) | EsxG protein | Identify aptamers against EsxG over its homologue EsxA. | N/A | 5 | Surface Plasmon Resonance (SPR) | N/A | Detection | SPR based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0408 | 24813997 | 2014 | Selection of RNA aptamers against the M. tuberculosis EsxG protein using surface plasmon resonance-based SELEX | G70 | UAAUACGACUCACUAUAGGGAGACAAGACUAGACGCUCAA-ACUCGUGACACUUACGAACGACCUAUGGCGGGAGAAUCCUAGCCGCUACG-UUCGACAUGAGACUCACAACAGUUCCCUUUAGUGAGGGUUAAUU | 134 | N/A | ssRNA | Mycobacterium Tuberculosis (H37Rv) | EsxG protein | Identify aptamers against EsxG over its homologue EsxA. | N/A | 5 | Surface Plasmon Resonance (SPR) | N/A | Detection | SPR based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0435 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-2 | AGTATACGTATTACCTGCAGC-TGGGGGGTGGTTGGGGGTAGTATATCGGGTCAGTGGTGCG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0436 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-103 | AGTATACGTATTACCTGCAGC-GGGAGGCGTGAAGTGTGATGGTGTGGGGGGTAGTGGCCGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0437 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-109 | AGTATACGTATTACCTGCAGC-CCGCTCAACAAGGTGCTACAAAGATCCTGTGTCCCTTGGC-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0438 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-116 | AGTATACGTATTACCTGCAGC-TACTCGTTATTTCGTAGCACTTTTCCCCACCACCTTGGTG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | LM6-116 showed strong genus-specific binding affinity when screened against five different species within the Listeria genus. | 6 | Flow Cytometry | 74.4 ±52.69 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0439 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-118 | AGTATACGTATTACCTGCAGC-CTGGTATAGACGTTATTCGTCCGCTCTTGTATCCTTGTGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0440 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-121 | AGTATACGTATTACCTGCAGC-TGTCGGTGGGGGGTGGCTTGAGTACGTGACGTGGTGTGGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0441 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-2 | AGTATACGTATTACCTGCAGC-CCATTGTTCTATCGCTAGCTCGCTCTGGCCAGCTCCTTGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0442 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-6 | AGTATACGTATTACCTGCAGC-TCTGTGTTCCGTTTTCGATTCTTACTGTGTTTTCGGGTGC-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | 106.4 ±43.91 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0443 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-13 | AGTATACGTATTACCTGCAGC-TGGGGGGGGGGGGAGGGGTCGGTGAGCGTGGGAGGAGGAG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0444 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-74 | AGTATACGTATTACCTGCAGC-CCGACCTTCTATCCTTCCAGTTTTTTGTAAACTCTTCTGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0446 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mA_Apt1 | CACAGCGGGACAGUUUAGC-AUUAGCUAUCUUCCACGAUUCGAUCAGGCAGUACGUCGU-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | A limited neutralization of Stx2-mediated cytotoxicity and death of HeLa cells was observed with aptamer mA_Apt1 (~40% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | Best Candidate | N/A | N/A |
| ABdb_0447 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mB_Apt23 | CACAGCGGGACAGUUUAGC-ACAGUUAUCCGACUGCUAUUCGAUCAGGCAGUACGUAGC-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Inhibited Stx2 binding weakly in approximately 50% of HeLa cells. A limited neutralization of Stx2-mediated cytotoxicity and death of HeLa cells was observed with aptamer mB_Apt23 (~20% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0448 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mC_Apt41 | CACAGCGGGACAGUUUAGC-CAGGCUGUUCUGACGCAUAAGGAAUGCGCUGUUGCAGAG-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | mC_Apt41 neutralized 0.007 pmole of Stx2 (≤60% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0449 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mD_Apt46 | CACAGCGGGACAGUUUAGC-UUGGUCCUGCUUUGGAUAGUCGCGAAAGGGGUGCCACUG-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Inhibited Stx2 binding weakly in approximately 50% of HeLa cells. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0450 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pA_Apt1 | CACAGCGGGACAGUUUAGC-ACAGUUAUCCGACUGCUAUUCGAUCAGGCAGUACGUAGC-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Inhibited Stx2 binding weakly in approximately 50% of HeLa cells. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0451 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pB_Apt14 | CACAGCGGGACAGUUUAGC-ACCGAGCGGUUUUACGUCUCAAGUAGUAUCCCGUUUUGC-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Did not inhibit Stx2 binding. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0452 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pC_Apt22 | CACAGCGGGACAGUUUAGC-AUUAGCUAUCUUCCACGAUUCGAUCAGGCAGUACGUCGU-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | A limited neutralization of Stx2-mediated cytotoxicity and death of HeLa cells was observed with aptamer pC_Apt22 (≤60% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0453 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pD_Apt25 | CACAGCGGGACAGUUUAGC-UUGCCAUCCUGUACUAUGCUCUAUCGGGCGGUUUAGUGAUCCUUCGUCCAACUAUC-GGUAGGUGGGUGCGUCUAAA | 95 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Did not inhibit Stx2 binding. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0463 | 25096391 | 2014 | Development of ssDNA aptamers for the sensitive detection of Salmonella typhimurium and Salmonella enteritidis | Se1 | CACACCGGAAGGGATGCCACCTAAACCCC | 29 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify aptamers that can be used as detection probes in a polyvalent directed aptamer polymer (PDAP), which specifically bind to S. enteritidis and S. typhimurium. | The binding efficiency of the PDAP of Se1 was approximately 100-fold higher than that of the single aptamer. | 10 | Fluorescence Spectroscopy | 4.66 ± 0.35 μM (of single aptamer) and 57.86 ± 14.5 nM (of PDAP) | Detection | Whole Cell-SELEX | 5'-FAM Labeled, 3'-Thiolated and Poly-D-Lysine (PDL) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0464 | 25096391 | 2014 | Development of ssDNA aptamers for the sensitive detection of Salmonella typhimurium and Salmonella enteritidis | Se2 | CACAGATGACGTCTGGCACATAATTAACAC | 30 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify aptamers that can be used as detection probes in a polyvalent directed aptamer polymer (PDAP), which specifically bind to S. enteritidis and S. typhimurium. | The binding efficiency of the PDAP for Se2 was approximately 80-fold higher than that of the single aptamer. | 10 | Fluorescence Spectroscopy | 3.83 ± 0.10 μM (of single aptamer) and 55.84 ± 24.7 nM (of PDAP) | Detection | Whole Cell-SELEX | 5'-FAM Labeled, 3'-Thiolated and Poly-D-Lysine (PDL) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0465 | 25096391 | 2014 | Development of ssDNA aptamers for the sensitive detection of Salmonella typhimurium and Salmonella enteritidis | St1 | CCGATGTCCGTTAGGGCTCCTCCATAGAT | 29 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that can be used as detection probes in a polyvalent directed aptamer polymer (PDAP), which specifically bind to S. enteritidis and S. typhimurium. | The binding efficiency of the PDAPs of St1 was approximately 20-fold higher than that of the single aptamer. | 10 | Fluorescence Spectroscopy | 0.530 ± 0.01 μM (of single aptamer) and 25 ± 5.6 nM (of PDAP) | Detection | Whole Cell-SELEX | 5'-FAM Labeled, 3'-Thiolated and Poly-D-Lysine (PDL) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0468 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | b03 | TGGGAGCTCAGAATAAACGCTCAA-TTTTCCTGTTGTTGTTGTTTTTGGGGTTTTTTGTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0469 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | h03 | TGGGAGCTCAGAATAAACGCTCAA-ATTTGTTTTGTTGGTGTTGTTGGCAGGTTTTGTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0470 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | h04 | TGGGAGCTCAGAATAAACGCTCAA-TTTTTTGTTTTAGTTTTGTTTTGGTTTGTAGTGTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0471 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | c04 | TGGGAGCTCAGAATAAACGCTCAA-TGTTTTTTTGTGGGTTTGTTTTTTTCTTCTTTTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0472 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | c01 | TGGGAGCTCAGAATAAACGCTCAA-TGTCGTTGTCGTTTTGTGTTTTTTTGGTGTTTTTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0473 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | a04 | TGGGAGCTCAGAATAAACGCTCAA-TTGTTTGTTTTGGTTTTTTCGTTTTTTTTTGTTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0474 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | b02 | TGGGAGCTCAGAATAAACGCTCAA-TATGTTGTCTTTTGTTTTGTGTTTTTTGTTGGTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0475 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | f01 | TGGGAGCTCAGAATAAACGCTCAA-GTGGTATAGTTCTTTTTTTTTGTTTTTTTGTTTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | 150.8 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0476 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | b04 | TGGGAGCTCAGAATAAACGCTCAA-TGGTCTTGTCGTTTTATTGTTTTTTTTTTTCTGTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0477 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | e01 | TGGGAGCTCAGAATAAACGCTCAA-CTTTGTTCTTCTTTGCTTTTTTTTTCTTTTTTTGTT-CGACATGAGGCCCGGATCA | 79 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | Digoxigenin-aptamer could bind to the target L. monocytogenes with much higher specificity, resulting in a clear fluorescent signal. | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | 60.01 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0478 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | h02 | TGGGAGCTCAGAATAAACGCTCAA-TGTTTGTCTGTTTTCGTTTGTCTATTTGGTTCAGTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0479 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | e05 | TGGGAGCTCAGAATAAACGCTCAA-GCTGTTTTTTTCGTGTTGGGTTTTTTGTTTTGTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0480 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | d02 | TGGGAGCTCAGAATAAACGCTCAA-TTGTTTTTTTTTTTTGGTGTTTTTTTTTTATTTT-CGACATGAGGCCCGGATCA | 77 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0481 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | c03 | TGGGAGCTCAGAATAAACGCTCAA-TTGTTTGTTTTTTTTTTGGCTGTTATTTTGTTTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0482 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | d03 | TGGGAGCTCAGAATAAACGCTCAA-CTGTCTTTTGTTTTTGTTGTGTTTTTTTGTTTTTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0483 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | g02 | TGGGAGCTCAGAATAAACGCTCAA-TGTCACTAGGCTTTTGGGATTCTCTGTGCATTTTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0484 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | g01 | TGGGAGCTCAGAATAAACGCTCAA-TGTTGGTCTGTGTTATATTTTTTGTATCTCGTTCTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0485 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | g03 | TGGGAGCTCAGAATAAACGCTCAA-TTCCTGGTTTATGTTGGGTTTTTTTGTTTCCTGGTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0486 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | f04 | TGGGAGCTCAGAATAAACGCTCAA-GCCTTCTGCCTGTGTACGTTAGTGTTTGTGTCTATTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0487 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | d04 | TGGGAGCTCAGAATAAACGCTCAA-GGCTTTTTCGTCTTGTTCCTTGTTATTTGTTGTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0488 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | e03 | TGGGAGCTCAGAATAAACGCTCAA-GGTTGTGCTTTGTATTCTCTTTTCTGTTTGATTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0489 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | h01 | TGGGAGCTCAGAATAAACGCTCAA-TGTCTTTCCGTCGATATGCTGCTGACGCTTGGGGCTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0490 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | a02 | TGGGAGCTCAGAATAAACGCTCAA-TCACTGTTTGTCTGTTTGCTGGGTTTTTTGTTTTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0491 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | c02 | TGGGAGCTCAGAATAAACGCTCAA-CTCTCAATGTGTATCTTGTTGCCGTTGTTCTTGTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0492 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | d05 | TGGGAGCTCAGAATAAACGCTCAA-TGTAGTTTTTGTTTTGCGTGGTTTTAGATGCTGGCTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0493 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | e02 | TGGGAGCTCAGAATAAACGCTCAA-TGTACCGGTGGTATTGTTTATGGTTGGCTGTTCTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0494 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | c05 | TGGGAGCTCAGAATAAACGCTCAA-CAGCCGGGGTGCGGGGCAAGGAGAGCGCGGTCAATTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0495 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | f02 | TGGGAGCTCAGAATAAACGCTCAA-CGGGGTGGGACTTTTAGCGTATTTGTGCTGGCGTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0496 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | e04 | TGGGAGCTCAGAATAAACGCTCAA-GGGGGCGAGTGGAAGAGGCAGGGAAGGGAAATGCGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0497 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | g04 | TGGGAGCTCAGAATAAACGCTCAA-GGGGGGGGGGTATTGGCAGAGGTGGTTAGGTGGCCCTT-CGACATGAGGCCCGGATCA | 81 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0498 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | a03 | TGGGAGCTCAGAATAAACGCTCAA-GGCGGGAGGAGACCGACCAGGCTCAGGGTGGGGCGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0506 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 36 | CCGTCAGCCGAGGACCACAC-TTGGTTGCTGAATCCCCTCGTCTTGGCTTTCTTTGTCGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | Mtb36 aptamer bound to M. tuberculosis H37Ra bacteria more than 4 times for M. bovis and 70 times for E. coli bacteria. | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 5.09 ±1.43 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0507 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 17 | CCGTCAGCCGAGGACCACAC-GCGTCAATATGCTCGAGTCCCTTACTCCGTAATCTTGGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0508 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 57 | CCGTCAGCCGAGGACCACAC-GAGGCGGGGCGTACATGATGGAGGTGTTGTGTTCTTGGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0509 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 25 | CCGTCAGCCGAGGACCACAC-ATAGGAAGTATGCGGTCGTAGTTAATCGCCTGTCCTGGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0510 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 32 | CCGTCAGCCGAGGACCACAC-CTGGGCTCACTCACTGGCGTATCATTCGTCCGCGGTGGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0511 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 3 | CCGTCAGCCGAGGACCACAC-CGCTTCACGTGTCAGTGAATTTTCTCCATCGTTTGGTGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0512 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 40 | CCGTCAGCCGAGGACCACAC-TGTAGCGCATCTACGGGCTCTTCATTACGTCTATATCGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0513 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 33 | CCGTCAGCCGAGGACCACAC-TTCACACACGGGTATAAACGCTCTGGTATGTCAAGCCGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0514 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 35 | CCGTCAGCCGAGGACCACAC-TCGGACCTAGTGCTAGGGTCTCTAAGAAGTATCGGGGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0515 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 49 | CCGTCAGCCGAGGACCACAC-TTCTCCGATCTTAGTCAACTTGGACCATGAATGCGGGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0516 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 46 | CCGTCAGCCGAGGACCACAC-TATTTACGCTGACCGACGATTTTCTATCAGAGTGCCGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0517 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 13 | CCGTCAGCCGAGGACCACAC-CGATCACTGTACAGTCCTGGATAAGCCGTTCTTTCCGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0518 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 11 | CCGTCAGCCGAGGACCACAC-CGCCGGCCTTCTTACAAGACCTGTTCAATTCCCAGTGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0519 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 50 | CCGTCAGCCGAGGACCACAC-AGGCTCACGCCCTGTCAATACTGCCTCTTGTCCTTCCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0520 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 38 | CCGTCAGCCGAGGACCACAC-ATTCGGCTGAAGACCCGAGCCGGTCATCCGGTGTTCCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0521 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 28 | CCGTCAGCCGAGGACCACAC-CTCCATCACGTGTAGTCAGCTGACCATTGATCGTGCCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0522 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 8 | CCGTCAGCCGAGGACCACAC-CTATCCCGTGGTCCATTGCTTTTCCCGGTCTCTTCTCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0523 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 52 | CCGTCAGCCGAGGACCACAC-CTTTGTGCCGGGAAAAGACTGGCCTGTGTTGACTTGCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0524 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 2 | CCGTCAGCCGAGGACCACAC-CGGCGCTTTTCTCATCCTACCTCCGCTCTTACCTGTATGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0525 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 9 | CCGTCAGCCGAGGACCACAC-GCCGTGCTGAGTCTGTCAGCAGTTTGCTAGTCTTCCCTGC-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0526 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 44 | CCGTCAGCCGAGGACCACAC-TTACACGAAGGCTCGGCCCATCTCTCTCGTGTCACTTCGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0559 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | E-CA 20 | CACACACGGAACCCCGACAACATACATACGGTGAGGGTGG | 40 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | Showed a 55% increase in the gated fluorescence intensities above background. | 8 | Flow Cytometry | 7 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0560 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | E-CA 20P | TTCACGGTAGCACGCATAGG-CACACACGGAACCCCGACAACATACATACGGTGAGGGTGG-CATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | Showed a 61% increase in the gated fluorescence intensities above background. | 8 | Flow Cytometry | 12 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0561 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | D-Cells 9 | GGGGAGGAGAAAAAGAGGACCAGAGTAACGATTCGTGGGG | 40 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | Showed a 55% increase in the gated fluorescence intensities above background. | 8 | Flow Cytometry | 71 ± 23 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0562 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | D-Cells 9P | TTCACGGTAGCACGCATAGG-GGGGAGGAGAAAAAGAGGACCAGAGTAACGATTCGTGGGG-CATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | D-Cells 9P showed an increase in the gated fluorescence above background by 65%. | 8 | Flow Cytometry | 44 ± 8 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0563 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | E-Cells 1P | TTCACGGTAGCACGCATAGG-GGGGAGGAGAAAAGAGGACCAGAGTAACGATTCGTGGGG-CATCTGACCTCTGTGCTGCT | 79 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | N/A | 8 | Flow Cytometry | 20 ± 3 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0564 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | E-Cells 1 | GGGGAGGAGAAAAGAGGACCAGAGTAACGATTCGTGGGG | 39 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | N/A | 8 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0565 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | D-Cells 20P | TTCACGGTAGCACGCATAGG-GGGGAGGAGAAATAGAGGACCAGAGTAACGATTCGTGGGG-CATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | N/A | 8 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0566 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | A2 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-ACGGGCGTGGGAGGCAATGCCTTGCTTGTAGGCTTCCCCTGTGCGCG-GGTGGATCCATATTCCTACTCG | 107 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0567 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | A14 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT-GGTGGATCCATATTCCTACTCG | 108 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | Showed specific binding to S. aureus. | 16 | Fluorescence Spectroscopy | 3.49 ± 1.43 nM | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0568 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | A15 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CACGCGCAAACAGATTAACACTCCGCCTAAGTCTGCCGCACGC-GGTGGATCCATATTCCTACTCG | 103 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0569 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | A20 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCAGCGGGGGCTGCGCGGTGGAGTGCTGTGGGCG-GGTGGATCCATATTCCTACTCG | 98 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0570 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | B3 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGGAGCCAGGATGGGAGGTCTGTAGGTCTGCGGGGCGTG-GGTGGATCCATATTCCTACTCG | 104 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | Showed specific binding to S. aureus. | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0571 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | B6 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGTCGGTGTCTGCCGGGGGATGTGGAGGCTGGGTGTTGCGCG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | Showed specific binding to S. aureus. | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0572 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | B7 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGGGCGGGCTACCTGGCTAGTACGCCATGATGCCTGCACGCG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0573 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | B15 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CACGCGCAAACAGATTAACACTCCGCCTAAGTCTGCCGCACGC-GGTGGATCCATATTCCTACTCG | 103 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0574 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/8 | ATACCAGCTTATTCAATT-AGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | PA#2/8 competes with IgG or IgG-Fc for binding to Protein A. | 11 | Bead-based Binding Assay | 1.06 ±0.2 μM | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0575 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#4/22 | ATACCAGCTTATTCAATT-GCAGTACTGATGAGTGTAGCCGTATGATTATCGTTTGTGG-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0576 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#4/34 | ATACCAGCTTATTCAATT-CCCCAACGAGTCGATATGTAGCCCACACTCTGATTCGTCC-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0577 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/11 | ATACCAGCTTATTCAATT-GGAGACGACAAACTATTACGTACTACGGCATGCACTTGGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0578 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/3 | ATACCAGCTTATTCAATT-CGACAAGTGGGCATTACGATTCTAGCCCTGATTATGTTCC-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0579 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/6 | ATACCAGCTTATTCAATT-ACCGATCACTAGCCGACTAATTGGTTTCCGATCGCAGTCC-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0580 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#14/82 | ATACCAGCTTATTCAATT-CCACAACCGAACTCGTAAGACGTATGTAGCCGCCAACTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0581 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#6/52 | ATACCAGCTTATTCAATT-ACGCATTGGAGCCCGAAACTGATTCATTGAGCCTACCTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0582 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/14 | ATACCAGCTTATTCAATT-ACGACCGTAGACGACTTACACTGATGTTGCGCATTTCTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0583 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#4/31 | ATACCAGCTTATTCAATT-CGATGACGACTGTAGCCGCAATACGCCCCTGTTACGTTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0584 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#6/41 | ATACCAGCTTATTCAATT-GGACGCCGACTAACTTTACGTGGTTCTCCTACCGCCTAACC-ACAATCGTAATCAGTTAG | 77 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0585 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#6/43 | ATACCAGCTTATTCAATT-ACGAAATGTAGCCGATCCTGATTACTCTCTGTCAGCTTGG-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0586 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-1 | CGGATCCATGGGCACTATTTATATCAA-TATGCCAGCATTTCGCCAACGGTGGTCATACAGTGTGAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0587 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-2 | CGGATCCATGGGCACTATTTATATCAA-GGGTATCCCACTCGGACGTTCATACCTGGCTGGTTGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0588 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-3 | CGGATCCATGGGCACTATTTATATCAA-AGCGCGTTTTGGACATGCGCTAGCTTCAATTTGAGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0589 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-4 | CGGATCCATGGGCACTATTTATATCAA-GCCAATGCACTCTGGTTATTCCCCTAAACATCCCGGAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0590 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-5 | CGGATCCATGGGCACTATTTATATCAA-CGTTTGGGGCTGTGTTGCAAGACCGTACGTTGCCCCCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0591 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-6 | CGGATCCATGGGCACTATTTATATCAA-TGCAACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0592 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-7 | CGGATCCATGGGCACTATTTATATCAA-TGGTACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0593 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-8 | CGGATCCATGGGCACTATTTATATCAA-TTACAGTATCCTCCCACGTTGGTTCGTGTCTTACGGAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0594 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-1 | CGGATCCATGGGCACTATTTATATCAA-CCCGTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0595 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-2 | CGGATCCATGGGCACTATTTATATCAA-GGCTAGGCCCCGGATCACCACTTTCCCTGCTTGATGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0596 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-3 | CGGATCCATGGGCACTATTTATATCAA-CCTTACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0597 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-4 | CGGATCCATGGGCACTATTTATATCAA-GGCGTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0598 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-5 | CGGATCCATGGGCACTATTTATATCAA-CTGCACGTGGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0599 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-6 | CGGATCCATGGGCACTATTTATATCAA-GACTACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0600 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-7 | CGGATCCATGGGCACTATTTATATCAA-GCCATTCGTCACTGAGTTGCTCTAGTGCCGTGTGCTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0601 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-8 | CGGATCCATGGGCACTATTTATATCAA-CTAAACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0602 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-1 | CGGATCCATGGGCACTATTTATATCAA-GCATCGGTCCTGAAGTTGCTCTAGTGCCCGTGTGCTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0603 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-2 | CGGATCCATGGGCACTATTTATATCAA-GGGCTAGCCCCGGATCACCACTTTCCCTGCTTGATGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0604 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-3 | CGGATCCATGGGCACTATTTATATCAA-TGTAACGGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0605 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-4 | CGGATCCATGGGCACTATTTATATCAA-TGGCACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0606 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-5 | CGGATCCATGGGCACTATTTATATCAA-CCTAACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0607 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-6 | CGGATCCATGGGCACTATTTATATCAA-CGGTTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0608 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-7 | CGGATCCATGGGCACTATTTATATCAA-GTGTTTCGCGCTATTTCCGTACAACCCGCGGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0609 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-1 | CGGATCCATGGGCACTATTTATATCAA-CCTCACATAGTGACGATGTGGTTTGGTACCTCTATGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0610 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-2 | CGGATCCATGGGCACTATTTATATCAA-CCGTGGATGTACGAAATTAACCGCACACCTAGCTACCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0611 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-3 | CGGATCCATGGGCACTATTTATATCAA-CGCATGCTTCTCGGGATACGGGCGGCTCGATAGAGTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0612 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-4 | CGGATCCATGGGCACTATTTATATCAA-GCTTACTACGTTTGCCTCAGTGTGTTCCGGTCTTAACAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0613 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-5 | CGGATCCATGGGCACTATTTATATCAA-CCCATACCTTTTTCGATAGTAAGTGCCATGCCCATCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0614 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-6 | CGGATCCATGGGCACTATTTATATCAA-GCCTAGAACCCCCTGTCTAGTCAAGTAGTGCGAGTGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0615 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-7 | CGGATCCATGGGCACTATTTATATCAA-GCCTTACCGCTCTATCACTCGTCTGTTGCCACTCAGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0616 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-8 | CGGATCCATGGGCACTATTTATATCAA-TGCGCCGATAGTTTCGATCATGATGCATCTGGCTGTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0617 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-9 | CGGATCCATGGGCACTATTTATATCAA-CGGTAGTACTACTGGAGACAACTTCGCATACTTTAGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0618 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-1 | CGGATCCATGGGCACTATTTATATCAA-TTGCTACAGGTATTGCACAACCTCGTGTGGTGTCCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0619 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-2 | CGGATCCATGGGCACTATTTATATCAA-CGGTAGTACTACTGGAGACAACTTCGCATACTTTAGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0620 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-3 | CGGATCCATGGGCACTATTTATATCAA-GCTGGCAACTGGATGCACTCGTCCTCAGCCTCGGTCAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0621 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-4 | CGGATCCATGGGCACTATTTATATCAA-GCCCGTGAGACTATACCCTATGCACTAGTTGCGTAATAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0622 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-5 | CGGATCCATGGGCACTATTTATATCAA-GCTCGCGTCTGAGGGAAGTTACGTTATTTCGCTTGTAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0623 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-6 | CGGATCCATGGGCACTATTTATATCAA-CCGGACTTTAAGCGGCTTCTCGTGGCTGGGTAATCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0624 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-7 | CGGATCCATGGGCACTATTTATATCAA-CCTGACCGATGTTGTATTAATGGCTCCGGGTCTTATGAG-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0625 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-8 | CGGATCCATGGGCACTATTTATATCAA-CGAGGGGTTGGTTTGTGGTGTTGCCGCCACTACAGCCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0644 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.06 | TGTACCGTCTGAGCGATTCGTAC-GATTACTATAATTTCCTATCGTCCGACCGCCGTC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | Display a sensitive detection of 200 nM alpha toxin. | 12 | Surface Plasmon Resonance (SPR) | 93.7 ± 7.0 nM | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) or 5'-FAM Labeled | N/A | N/A | N/A | Average half-life of ssDNA MREs in serum is about one hour. | N/A |
| ABdb_0645 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.26 | TGTACCGTCTGAGCGATTCGTAC-CCTTGCCGATGCCTTTACGGTCTAGTTTGGATGT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0646 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.01 | TGTACCGTCTGAGCGATTCGTAC-TCGGGCGATGATACTTAGCACGGTCTAGGTCAAA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0647 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.20 | TGTACCGTCTGAGCGATTCGTAC-TAGCGGCAGAGTAGCACTCTATAGGTCGATGTTT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0648 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.02 | TGTACCGTCTGAGCGATTCGTAC-CGTGTCCTATTTTCTTCTCTGTTAACTCTCGTC-AGCCAGTCAGTGTTAAGGAGTGC | 79 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0649 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.06 | TGTACCGTCTGAGCGATTCGTAC-GATTACTATAATTTCTTATCGTCCGACCGCCGTC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0650 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.39 | TGTACCGTCTGAGCGATTCGTAC-TTTGATCTCGTGTGTCTAGTTGCGGCGGATTGTC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0651 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.10 | TGTACCGTCTGAGCGATTCGTAC-GGTCAACCTCACCGACTGCCGACCGTTTAATTCG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0652 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.43 | TGTACCGTCTGAGCGATTCGTAC-CGTCATTGCCTCGTAGTATTCTTATAGTCGGTAG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0653 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.44 | TGTACCGTCTGAGCGATTCGTAC-TCCCGAAAGCGCGTCAGCCTGGGAGGTTATGCGG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0709 | https://doi.org/10.1016/j.lwt.2015.07.021 | 2015 | Identification and characteristics of aptamers against inactivated Vibrio alginolyticus | Aptamer #7 | TCAGTCGCTTCGCCGTCTCCTTC-GGGGGCGCGGTGAGGGGCTGCACAAGAGGGAG-GCACAAGAGGGAGACCCCAGAGGG | 79 | N/A | ssDNA | Vibrio Alginolyticus | Whole cell | Develop an aptamer detection assay for inactivated V. alginolyticus. | The detection limit for aptamer #7 for inactivated V. alginolyticus was 10 cells/ml. | N/A | Fluorescence Spectroscopy | 28.39 ± 11.46 nM | Detection | N/A | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0710 | https://doi.org/10.1016/j.lwt.2015.07.021 | 2015 | Identification and characteristics of aptamers against inactivated Vibrio alginolyticus | Aptamer #8 | TCAGTCGCTTCGCCGTCTCCTTC-AGCCGGGGTGGTCAGTAGGAGCAGCACAAGAGGGA-GCACAAGAGGGAGACCCCAGAGGG | 82 | N/A | ssDNA | Vibrio Alginolyticus | Whole cell | Develop an aptamer detection assay for inactivated V. alginolyticus. | The detection limit for aptamer #8 for inactivated V. alginolyticus was 10 cells/ml. | N/A | Fluorescence Spectroscopy | 12.82 ± 6.00 nM | Detection | N/A | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0711 | https://doi.org/10.1016/j.lwt.2015.07.021 | 2015 | Identification and characteristics of aptamers against inactivated Vibrio alginolyticus | Aptamer #23 | TCAGTCGCTTCGCCGTCTCCTTC-GTAGGAGGTAGTCGGAGAGGCGAATGAGAGGGGAAGCACAAGAGGGA-GCACAAGAGGGAGACCCCAGAGGG | 94 | N/A | ssDNA | Vibrio Alginolyticus | Whole cell | Develop an aptamer detection assay for inactivated V. alginolyticus. | The detection limit for aptamer #23 for inactivated V. alginolyticus was 10(3) cells/ml. | N/A | Fluorescence Spectroscopy | 46.89 ± 15.87 nM | Detection | N/A | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0713 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp1 | TGAGCCCAAGCCCTGGTATG-TTCTTCCCTTTTATTAGTCCTGTATTCCTCTACTGTTGCC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | With sandwich Sp1 and Sp20, the aptamer assay achieved a concentration range for S. sonnei of 10(2) cfu/mL to 10(7) cfu/mL and a detection limit of 30 cfu/mL. | 12 | Flow Cytometry | 5.98 ± 0.835 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled and Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0714 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp13 | TGAGCCCAAGCCCTGGTATG-TATCCGATTTTATCTGTCCAATATTCCCTGTGTCTACCTT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 97.38 ± 36.2 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0715 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp16 | TGAGCCCAAGCCCTGGTATG-TATCTTCACTTGACCTTTACCGCAATCGTCCATGTATCTG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 682.2 ± 125 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0716 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp19 | TGAGCCCAAGCCCTGGTATG-TTCTACCCAACTGCTTTAATAGTCACTGTCATAGTTCCAC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0717 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp20 | TGAGCCCAAGCCCTGGTATG-TCGTCGATTATTGTTTCAGTTCAGTTCCCCCGCGTTCCGA-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | With sandwich Sp1 and Sp20, the aptamer assay achieved a concentration range for S. sonnei of 10(2) cfu/mL to 10(7) cfu/mL and a detection limit of 30 cfu/mL. | 12 | Flow Cytometry | 14.32 ± 2.19 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled and HEX (hexachlorofluorescein) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0718 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp22 | TGAGCCCAAGCCCTGGTATG-CCTACCTTAGTCCGTTTCGCTGTGTTTGTCCAATATTCCT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 4.98 ± 0.357 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0719 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp23 | TGAGCCCAAGCCCTGGTATG-CTTCACTTGACCCTTATCGCTTCTAACACAACCGCTTTTT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 5.735 ± 0.478 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0720 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp28 | TGAGCCCAAGCCCTGGTATG-TATTCCCCCTTATTTTAGCCATTTTGTTACATCTTCCGTC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 72.89 ± 22.16 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0721 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp29 | TGAGCCCAAGCCCTGGTATG-ATATTCGTTCTTTTCGCCTTAACTTCTCGTGTTTCCTTAC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 47.83 ± 9.7 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0761 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-52 | CATACGATTTAGGTGACACTATAG-CCGCCCAGCGGGGGTAGGGCCGGACGTAGGAGGAGCTGCG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | P12-52 bound strongly to all three Gram-positive bacteria tested (S. aureus, E. faecalis and E. freudini). | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 11.97 ± 2.94 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0762 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-31 | CATACGATTTAGGTGACACTATAG-CCCTCCGGGGGGGGGGGTCATCGGGATACCTGGTAAGGATA-ATTTCTCCTACTGGGATAGGTGGA | 89 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | The binding of P12-31 was 10-fold stronger than that of the random library. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 87.03 ± 17.32 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0763 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-55 | CATACGATTTAGGTGACACTATAG-CCGGAGGGGGGTGAGGTCTGCGGCAGGCTGTGTGGGTGGA-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | The binding of P12-55 to E. coli cells was more than 100-fold stronger than that of the random library. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 161.0 ± 34.74 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0764 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-17 | CATACGATTTAGGTGACACTATAG-GACGGTGGCAGGGAAAGGGGTCGGGCATATGGCGGAGGGG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | P12-17 could only bind to E. faecalis. The binding of P12-17 was 10-fold stronger than that of the random library. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 56.33 ± 15.87 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0765 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-11 | CATACGATTTAGGTGACACTATAG-CCCTCCGGGGGGGTCATCGGGATACCTGGTAAGGATA-ATTTCTCCTACTGGGATAGGTGGA | 85 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0766 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-21 | CATACGATTTAGGTGACACTATAG-CCGGAGGTGGGTGAGGTCTGCGGCAGGCTGTGTGGGTGGA-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0767 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-9 | CATACGATTTAGGTGACACTATAG-TGCGGGCGGAGGACACGGACCCGTATGGGAGCAATGCACG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0768 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-15 | CATACGATTTAGGTGACACTATAG-GGCCACCCACAGGCACTCCGCTCATGAATCGTGGAGTCGG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0769 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-30 | CATACGATTTAGGTGACACTATAG-CACCACGGACACGATCCCAAGCTAGGAGGTGCGGCGGGGT-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0770 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-48 | CATACGATTTAGGTGACACTATAG-TGGCACAGCACGTCGCACGGTCCCCGGGAGGTGTTCACTG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0771 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-51 | CATACGATTTAGGTGACACTATAG-TCGCGAGTGCGTGTACGCCACACATCACAAAAGGGGTGTG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0772 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-66 | CATACGATTTAGGTGACACTATAG-GGCAACATTCAGACATACCAGTACCCACTCGGACTTCCCG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0780 | 28121169 | 2016 | Development of a DNA aptamer that binds specifically to group A Streptococcus serotype M3 | 12L18A | GCCTGTTGTGAGCCTCCTAAC-TCCTCGAGGGGGGGGGGATGAAAAGGAAAACGCAACAA-CATGCTTATTCTTGTCTCC | 78 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Group A Streptococcus (GAS) serotype M3 | Whole cell | Identify aptamers against S. pyogenes serotype M3. | 74% efficiency toward the S. pyogenes serotype M3. | 12 | Flow Cytometry | 7.47 ± 1.72 pM | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0781 | 28121169 | 2016 | Development of a DNA aptamer that binds specifically to group A Streptococcus serotype M3 | 12L12A | GCCTGTTGTGAGCCTCCTAAC-GAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATA-CATGCTTATTCTTGTCTCC | 78 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Group A Streptococcus (GAS) serotype M3 | Whole cell | Identify aptamers against S. pyogenes serotype M3. | N/A | 12 | Flow Cytometry | 8.25 ± 1.43 pM | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0784 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8 | ATACCAGCTTATTCAATT-AGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | PA#2/8 and its truncated variant PA#2/8[S1-58] were able to differentiate between the highly Protein A-producing S. aureus Cowan strain. | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | 101.4 ± 5.9 nM (of 3′-biotinylated) and 189.9 ± 13.0 nM (of 5′-biotinylated) | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0785 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S1-58] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT | 58 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | PA#2/8 and its truncated variant PA#2/8[S1-58] were able to differentiate between the highly Protein A-producing S. aureus Cowan strain. | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | 11.3 ± 1.4 nM (of 3′-biotinylated) and 23.7 ± 2.0 nM (of 5′-biotinylated) | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0786 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S1-50] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTC | 50 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | N/A | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0787 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S1-43] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGG | 43 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | N/A | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0788 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S28-50] | AGGGGGATAGAGGGGGTGGGTTC | 23 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | N/A | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0809 | 27411775 | 2016 | Rapid and Selective Detection of Pathogenic Bacteria in Bloodstream Infections with Aptamer-Based Recognition | Apt-S. aureus | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACTTTTTTTTT | 71 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Aptamer-based capture platform using Fe3O4@mTiO2 magnetic nanoparticles for the detection of bacteria. | Display a favourable bacterial-capture efficiency of about 80% even at low infectious doses (10–2000 CFU/mL). | N/A | N/A | N/A | Detection | N/A | 3'-Amidation (NH₂-(CH2)7) and 3'-FAM Labeled ((CH2)7-FAM) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0810 | 27411775 | 2016 | Rapid and Selective Detection of Pathogenic Bacteria in Bloodstream Infections with Aptamer-Based Recognition | Apt-E. coli | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTATTTTTTTTTT | 81 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Aptamer-based capture platform using Fe3O4@mTiO2 magnetic nanoparticles for the detection of bacteria. | Display a favourable bacterial-capture efficiency of about 80% even at low infectious doses (10–2000 CFU/mL). | N/A | N/A | N/A | Detection | N/A | 3'-Amidation (NH₂-(CH2)7) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0814 | 26768582 | 2016 | DNA aptamers for the detection of Haemophilus influenzae type b by cell SELEX | Clone 63 | GCCTGTTGTGAGCCTCCTAAC-AGGAGGCGAACGGGCAGGTTCTTGGGGAGACAAGAATAAG-CATGCTTATTCTTGTCTCC | 80 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Haemophilus Influenzae type b (Hib) (ATCC 10211) | Whole cell | Identify an aptamer against Hib for the detection of H. influenzae. | Clone 63 could detect Hib in patients’ CSF samples at 60 CFU/mL. | 7 | Flow Cytometry | 28.46 pM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0815 | 26768582 | 2016 | DNA aptamers for the detection of Haemophilus influenzae type b by cell SELEX | Clone 2, 42, 45 | GCCTGTTGTGAGCCTCCTAAC-GCCAGGTGTTTTGGCGGTAGGGGTGAAACAACAGGGGG-CATGCTTATTCTTGTCTCC | 78 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Haemophilus Influenzae type b (Hib) (ATCC 10211) | Whole cell | Identify an aptamer against Hib for the detection of H. influenzae. | N/A | 7 | Flow Cytometry | 47.10 pM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0834 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN08 | ATGAGAGCGTCGGTGTGGTAACTTAATCCTCTAGTTTTAATTCTAGATACGGCGCATGCACTCTATGTAGGAGGGTGCGGAAGTA | 85 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 54.9 ± 7.8 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0835 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN27 | ATGAGAGCGTCGGTGTGGTAACTAGTCTGATTTCTATTTCCTTTAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA | 86 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 28.5 ± 4.9 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0836 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN27.SH | TAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA | 43 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 26.9 ± 5.6 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0837 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN08.SH | ATGCACTCTATGTAGGAGGGTGCGGA | 26 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 52.9 ± 10.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0838 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN17.SH | ATCCTCCTATCTATCGGTAGTTGTAGGAGGGTGCGG | 36 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 29 ± 7.3 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0839 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN21.SH | AGAGCGTCGGTGTGGTAACTGTTCAGGAGGATGACATTGTCGCCT | 45 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 18.1 ± 3.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0840 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St17Lp21 | ATCCTCCTAGGTAACTGTTCAGGATGTAGGAGGGT | 35 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 16.9 ± 3.9 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0841 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St21Lp17 | AAGCGTCGGTGTTCTATCGGTAGTTGACACCGACGCCT | 38 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 13.5 ± 2 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0842 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St08Lp17 | ATGCACTCTTCTATCGGTAGTTGAGGGTGCGG | 32 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 12.5 ± 2.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0843 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-6 | CGTGATGATGTTGAGTTG-GGGTGATGGGTGCATGTGATGAAAGGGGTTCGTGCTATGCTGTTTTGTCTAATAATACTAGTCCTTGCCAAGGTTTATTC-CAGTAATGCCAACCAATCT | 117 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | 66.26% fluorescent cell intensity for E. coli O157 with less cross-reactivity. | 10 | Flow Cytometry | 107.6 ± 67.8 pM | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0844 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-5 | CGTGATGATGTTGAGTTG-GAGTTGCGTTGCTGAATGCATGGGCTGTACTAGGTTGGTGCTACTCTGTAATGTCTACTATTACTATTCCATCGCAACGTATACTG-CAGTAATGCCAACCAATCT | 123 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | 57.41% fluorescent cell intensity for E. coli O157 with less cross-reactivity. | 10 | Flow Cytometry | 120.4 ± 32.2 pM | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0845 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-1 | CGTGATGATGTTGAGTTG-GCCGAGATTGAAGCTGGTGACCATTGGCCTTACTGGGATGCTCTTGTGATTACTACTACTAATCGTTGTGAACGTAAATGC-CAGTAATGCCAACCAATCT | 118 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | N/A | 10 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0846 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-2 | CGTGATGATGTTGAGTTG-GTGTTAATCCGTGTATGCCATGAGACCGGTAAGTCCTATTTTCGCTCCTGGAATGGTACAAGCTCATGTCAAGATATACTC-CAGTAATGCCAACCAATCT | 118 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | N/A | 10 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0847 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-3 | CGTGATGATGTTGAGTTG-GGGCAGATCCGTGCACATGATCTTAGCCGTACGTGTTCTGCGGTATAGTCTATTCATACTACCACTTCGCAATGTATATCG-CAGTAATGCCAACCAATCT | 118 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | N/A | 10 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0848 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-4 | CGTGATGATGTTGAGTTG-GTCGAGTACGGATCACTTGGAGATTGGCCATCGAGCTATTCTGTAATGTGTAATCCTACTACACCTTCGCATCGTTAATGC-CAGTAATGCCAACCAATCT | 118 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | N/A | 10 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0849 | 28941453 | 2017 | Development of a DNA Aptamer for Screening Neisseria meningitidis Serogroup B by Cell SELEX | K3 | GCCTGTTGTGAGCCTCCTAACGCCAGGCGTTTTGGCCGTAGGCGTGGGAGACAAGAATAAGCA | 63 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Neisseria Meningitidis Serogroup B (ATCC 13090) | Whole cell | Identity aptamers bind to and detect N. meningitidis in patients’ CSF samples. | Detected 10(2) CFU of CSF isolated N. meningitidis. | 6 | Flow Cytometry | 28.3 ± 8.9 pM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0850 | 28941453 | 2017 | Development of a DNA Aptamer for Screening Neisseria meningitidis Serogroup B by Cell SELEX | K4 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Neisseria Meningitidis Serogroup B (ATCC 13090) | Whole cell | Identity aptamers bind to and detect N. meningitidis in patients’ CSF samples. | N/A | 6 | Flow Cytometry | 39.1 ± 8.6 pM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0932 | 27696554 | 2017 | Evaluation of Staphylococcus aureus DNA aptamer by enzyme-linked aptamer assay and isothermal titration calorimetry | SA31 | TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA | 45 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | ELAA and ITC to study impact of temperature and ion concentration in the binding of aptamer to its target on surface of bacteria. | Both temperature and salt concentration directly influenced the 3D structure of the DNA molecule under specified experimental conditions, thereby altering the aptamer's affinity for its target. | N/A | N/A | N/A | Detection | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0933 | 28454652 | 2017 | Selection, characterization, and application of DNA aptamers for detection of Mycobacterium tuberculosis secreted protein MPT64 | Aptamer 17 | TCACTTCAAATGTGCGCTTC-GTCAACAGTCCAGTTGGGAGGTCGCTTATAGCTGCTTGTC-CGTCAAAACAGGGGGTAGAA | 80 | 5'-TCACTTCAAATGTGCGCTTC-N40-CGTCAAAACAGGGGGTAGAA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | MPT64 protein (Rv1980c) | Identify DNA aptamers against MPT64 protein. | The ELONA assay had a sensitivity and specificity of 91.3% and 90% on sputum samples. | 10 | Surface Plasmon Resonance (SPR) | 8.92 nM | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0935 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.1A | GCGC(U^y)CGCGCGGCG(U^y)GC-ACAACAAA(U^y)G(U^y)GACCA(U^y)GCGA(U^y)(U^y)CCCCA(U^y)A(U^y)CCAGGCACA-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0936 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.2A | GCGC(U^y)CGCGCGGCG(U^y)GC-GA(U^y)GCG(U^y)G(U^y)GG(U^y)G(U^y)GGAG(U^y)(U^y)G(U^y)G(U^y)GAG(U^y)GG(U^y)C(U^y)GCG(U^y)(U^y)G(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0937 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.5B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)(U^y)CA(U^y)GCCC(U^y)G(U^y)G(U^y)C(U^y)(U^y)GC(U^y)C(U^y)(U^y)G(U^y)GAG(U^y)(U^y)G(U^y)(U^y)G(U^y)G(U^y)CA-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0938 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.8A | GCGC(U^y)CGCGCGGCG(U^y)GC-G(U^y)G(U^y)G(U^y)A(U^y)GCG(U^y)(U^y)CA(U^y)G(U^y)GG(U^y)GAGG(U^y)C(U^y)(U^y)GCG(U^y)C(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0939 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.10A | GCGC(U^y)CGCGCGGCG(U^y)GC-GAG(U^y)G(U^y)G(U^y)G(U^y)GGG(U^y)CCGAG(U^y)GGG(U^y)GG(U^y)CAGGG(U^y)(U^y)(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%. | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0940 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.14B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)C(U^y)G(U^y)G(U^y)GCGG(U^y)G(U^y)(U^y)A(U^y)GCGGG(U^y)(U^y)GGG(U^y)(U^y)G(U^y)(U^y)(U^y)G(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%. | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0941 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.16B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)(U^y)(U^y)GCG(U^y)CCGGG(U^y)(U^y)(U^y)A(U^y)GCGGG(U^y)(U^y)G(U^y)C(U^y)CG(U^y)G(U^y)C(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0942 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.17B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)C(U^y)(U^y)G(U^y)(U^y)GGG(U^y)CGACGG(U^y)C(U^y)G(U^y)(U^y)CA(U^y)G(U^y)GGG(U^y)G(U^y)(U^y)G(U^y)CCC-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0943 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.18B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)(U^y)G(U^y)G(U^y)(U^y)CACG(U^y)CA(U^y)(U^y)(U^y)CGCAC(U^y)CC(U^y)C(U^y)CAGC(U^y)ACG(U^y)(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%. | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0944 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.24A | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)G(U^y)G(U^y)(U^y)(U^y)G(U^y)GG(U^y)ACGAGCG(U^y)G(U^y)G(U^y)GGA(U^y)GG(U^y)CCG(U^y)G(U^y)CA-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0945 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.28A | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)CC(U^y)CGCG(U^y)(U^y)(U^y)GGA(U^y)(U^y)CA(U^y)G(U^y)(U^y)GG(U^y)(U^y)(U^y)G(U^y)CGG(U^y)G(U^y)A(U^y)(U^y)G(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%. | 12 | Saturation Binding Assay | 27.4 ± 18.7 nM | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) and Radiolabelled ([γ-32P]-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0946 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.30A | GCGC(U^y)CGCGCGGCG(U^y)GC-ACAGAAAG(U^y)G(U^y)GGCCA(U^y)G(U^y)G(U^y)(U^y)G(U^y)G(U^y)CCC(U^y)GGCAGG(U^y)(U^y)AG(U^y)(U^y)(U^y)A-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 81 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0962 | 29594712 | 2017 | Fluorometric graphene oxide-based detection of Salmonella enteritis using a truncated DNA aptamer | SE54F | TACCAAAATGTTGGATTGGATGTTGTACTGGGTTGCATAGGTAGTCCAGAAGCC | 54 | N/A | ssDNA | Salmonella Enteritidis (S. Enteritidis) (ATCC 13076) | Whole cell | Truncated aptamer was used to develop a fluorometric graphene oxide (GO) based assay for the detection of S. enteriditis. | LOD of 38 and 25 cfu/mL for the full length SE54 and SE54T, respectively, with a linear response from 10(2) to 10(7) cfu/mL. | N/A | Fluorescence Spectroscopy | 6.3 nM | Detection | N/A | 5'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0963 | 29594712 | 2017 | Fluorometric graphene oxide-based detection of Salmonella enteritis using a truncated DNA aptamer | SE54T | GGATTGGATGTTGTACTGGGTTGCATAGG | 29 | N/A | ssDNA | Salmonella Enteritidis (S. Enteritidis) (ATCC 13076) | Whole cell | Truncated aptamer was used to develop a fluorometric graphene oxide (GO) based assay for the detection of S. enteriditis. | LOD of 38 and 25 cfu/mL for the full length SE54 and SE54T, respectively with a linear response from 10(2) to 10(7) cfu/mL. | N/A | Fluorescence Spectroscopy | 3.2 nM | Detection | N/A | 5'-Fluorescein Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0966 | https://doi.org/10.1016/j.snb.2017.07.074 | 2017 | A point-of-need enzyme linked aptamer assay for Mycobacterium tuberculosis detection using a smartphone | Direct Dot-Blot Aptamer | GGCGCCATAGCGACGGGGCCATTCCAAGAA | 30 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Smartphone-based method using enzyme-linked aptamers for point-of-need M.tb detection. | The direct dot-blot system provided a lower limit of quantitation of 10(4) CFU/mL and greater accuracy. | N/A | N/A | N/A | Detection | N/A | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0967 | https://doi.org/10.1016/j.snb.2017.07.074 | 2017 | A point-of-need enzyme linked aptamer assay for Mycobacterium tuberculosis detection using a smartphone | Indirect Dot-Blot Aptamer | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-GGCGCCATAGCGACGGGGCCATTCCAAGAA-GGGTCAATGCGTCATA | 88 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Smartphone-based method using enzyme-linked aptamers for point-of-need M.tb detection. | The limit of quantitation (LOQ) for indirect assays was 10(5) CFU/mL. | N/A | N/A | N/A | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0982 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-01 | CATATCCGCGTCGCTGCGCTCAGACCCACCACTACGCACC | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0983 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-02 | CATATCCGTGTCGCTGCGCTCAGACCCACCACCACGCACC | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0984 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-03 | CATATCCGCGTCGCTGCGCTCAGACCCACCACCACGCACC | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | STC-03 showed better affinity to E. aerogenes, K. pneumoniae, C. freundii, and B. subtilis. | 18 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 27.2 nM (for E. coli), 11.9 nM (for E. aerogenes), 9.22 nM (for K. pneumoniae), 15.9 nM (for C. freundii), 9.97 nM (for B. subtilis), and 16.4 nM (for S. epidermidis) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0985 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-04 | ATATCCGCGTCGCTGCGCTCAGACCCACCACCACGCACC | 39 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0986 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-05 | CATATCCGCGTCGCTGCGCTCAGACCCACCACCCGCCC | 38 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0987 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-06 | GGGCGGGGGTGCTGGGGGAATGGAGTGCTGCGTGCTGCGG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0988 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-07 | GGGCGGGGGGTGCTGGGGGAATGGAGTGCTGCGTGCTGCG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0989 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-08 | GGGCGGGGGTGCTGGGAGAATGGAGTGCTGCGTGCTGCAG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0990 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-09 | GGGCAGGTGTGCTGGGGGAATGGAGTGCTGCGTGCTGCGG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0991 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-10 | AGACCGCAGGTGCACCGGGCGACGTCTCTGGGTGTGGTGA | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0992 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-11 | AGACCGCAGGTGCACTGGGCGACGTCTCTGGGTGTGGTGT | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0993 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-12 | GGACCGCAGGTGCACTGGGCGACGTCTCTGGGTGTGGTGT | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | STC-12 showed better affinity to E. coli and S. epidermidis. | 18 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 38.5 nM (for E. coli), 33.7 nM (for E. aerogenes), 16.3 nM (for K. pneumoniae), 25.6 nM (for C. freundii), 18.9 nM (for B. subtilis), and 13.7 nM (for S. epidermidis) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0994 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-13 | GGACGCGCGTTGGTGGTGGATGGTGTGTTACACGTGTTGT | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0995 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-14 | CGGGGTGGGACCAGTCTTGCGCGGGTGAC | 29 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0996 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-15 | GGACTGGAGTCTAGACCGGGTAGCTGTGGT | 30 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1038 | 30563044 | 2018 | 2'-Fluoro-Pyrimidine-Modified RNA Aptamers Specific for Lipopolysaccharide Binding Protein (LBP) | A011 | CCAAGCUUGCAUGCCUGCAG-GGACUGUGGAUUGUUCUGGGUGCCGCUUCUCCGAAUAUCGGACUCUCGAACUCCUGGGGA-GGUACCGAGCUCGAAUUCCC | 100 | 5'-CCAAGCTTGCATGCCTGCAG-N60-GGTACCGAGCTCGAATTCCC-3' | ssRNA | Gram-negative Bacteria | Murine Lipopolysaccharide Binding Protein (mLBP) | Identify aptamers that bind to and inhibit the LPS-LBP interaction or block of LBP-mediated transfer of LPS monomers to CD14. | N/A | 8 | Nitrocellulose Filter Binding Assay | 267 ± 48 nM | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1039 | 30563044 | 2018 | 2'-Fluoro-Pyrimidine-Modified RNA Aptamers Specific for Lipopolysaccharide Binding Protein (LBP) | A036 | CCAAGCUUGCAUGCCUGCAG-GAUAUACGGUGCCGCUUCUCUAACCGGUGGUCAUGCGGUUGGACGCUCGAACAGACUA-GGUACCGAGCUCGAAUUCCC | 98 | 5'-CCAAGCTTGCATGCCTGCAG-N60-GGTACCGAGCTCGAATTCCC-3' | ssRNA | Gram-negative Bacteria | Murine Lipopolysaccharide Binding Protein (mLBP) | Identify aptamers that bind to and inhibit the LPS-LBP interaction or block of LBP-mediated transfer of LPS monomers to CD14. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1048 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-2 | TCAGCACGT-ATAAGCATGAATTGACCAACCTAAACTTATTCATTTTCCAGCACCTCTAATATTACTGGC-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | 75% binding affinity to V. parahaemolyticus than to other foodborne bacteria (less than 18%). | 8 | Flow Cytometry | 10.3 ± 4.5 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1049 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-1 | TCAGCACGT-AGCCCTATTTGTTTTCTCTTGTCTCTGTACTGCTGATGTTGGTCATTCTCTTTTCTCGGT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 19.2 ± 2.8 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1050 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-3 | TCAGCACGT-TATCTAGTCAGATATCCAGACAGTCGCGGCTGGAAGCTTCTGTTAAGAATTTGAGATACT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 25.2 ± 3.1 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1051 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-4 | TCAGCACGT-GCGGGCATTATTGCACTCCACGGCGAGTAGTGCTCACAGAGTCATTTACACCGGTCGTAT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 17.2 ± 5.1 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1052 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H7 | Apt-1 | TGAGCCCAAGCCCTGGTATG-TTACAGTATGCTACCTCTACTTGAAGGTTGGTCGACGCGG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 18.97 ± 1.73 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1053 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H8 | Apt-2 | TGAGCCCAAGCCCTGGTATG-TGATCGGTGACGAGGGTGCGGGGCGGGGGGTGAGGCACAG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 20.73 ± 2.29 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1054 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H9 | Apt-3 | TGAGCCCAAGCCCTGGTATG-TAGTAATGGTGCGTACAGGCGACGGGGTCCAGGCTGGAGG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 16.44 ± 2.16 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1055 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H10 | Apt-4 | TGAGCCCAAGCCCTGGTATG-AGCCCACGGAACACTGGTCGCGCCCACTGGTTTCTATATT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 15.13 ± 0.88 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1056 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H11 | Apt-5 | TGAGCCCAAGCCCTGGTATG-CGGATAACGAGGTATTCACGACTGGTCGTCAGGTATGGTT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | Apt-5 shows a strong affinity for all stages of bacterial growth (adjustment, log, and stationary phases). | 14 | Flow Cytometry | 9.04 ± 2.08 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1057 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H12 | Apt-6 | TGAGCCCAAGCCCTGGTATG-GTGTGCCTGTCGTTGTATTGGTCGGTAGGGATCGGAGTGG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 36.67 ± 4.55 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1058 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H13 | Apt-7 | TGAGCCCAAGCCCTGGTATG-TGTGGGGTCCTGGATTATGTTTAGCGTCTTTCGCAGTGGG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 17.11 ± 0.31 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1059 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H14 | Apt-8 | TGAGCCCAAGCCCTGGTATG-TCACATCCGGGTTCTTTGCGAACGCGTTTCCGCAGTCTCA-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 24.68 ± 1.95 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1060 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H15 | Apt-9 | TGAGCCCAAGCCCTGGTATG-TTGCGGGAGTCTAGCGGGCCACACTTTTATAGGTTCGCAG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 20.99 ± 0.37 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1061 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE40 | TACGACTCACTATAGGGATCC-ACCTATGGCAGATTGAGCCCAAGGGCTGTGCAGC-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | N/A | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1062 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE42 | TACGACTCACTATAGGGATCC-CCCCGAGTGAAGAGCAGGACAGCGGGACAGCGTC-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | N/A | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1063 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE43 | TACGACTCACTATAGGGATCC-GTGACTGTACGGGCTCAGTCGTTACTTGAGAGTT-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | SE43 bound to bacteria was four times higher compared with scrambled control and background controls, and twofold higher in PBS. | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1064 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE48 | TACGACTCACTATAGGGATCC-AATGGCACAGCGCCTGGAACGTACTCTGTACCTG-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | N/A | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1065 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE52 | TACGACTCACTATAGGGATCC-TTCGCATCCGGCACGATGGCTAGGACACCCCGAT-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | N/A | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1108 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt1 | AGGGTTGGTCGTCCAGCATTCCGTTCGATTGTAGTTCTGACTCTTGTGAAGTTAATGAGCTCCTTTTGCTGACTGTTGTT | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1109 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt2 | TTCTGATGAGAGTTGCGACCTCCCGGATGAGTGCCCTGGCTCCGGGTTTGTCTATTTTTGGGGGTGTTGACAGATATCCT | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | Vapt2 could detect the pathogen in a wide concentration range: 8–2.0 × 10^8 cfu/ml.The Limit of Detection (LOD) was 8 cfu/ml. | 13 | Fluorescence Microscopy | 26.8 ± 5.3 nM | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1110 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt3 | ATCGGATATGAGGCCGGGTATTAAGTGGGGTTCCATATGCAAGGCAGATCTCCCAGTGTTTTTTCAGGATTGCGTTACTG | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1111 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt4 | AAGAGGGCTTGGGAACTCTAGGCGTCTGTGCATTAAGCCATGTCTGCCGGGAAAGATCTGTGAAGTGTTCGCCCGCACTT | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1112 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt5 | GCATGGGTATAGGGAAACCCGAGTCTAGTTTACACTGACGTTAGGAGATTACGTCTGCCGACAGAACATTCTCTCTGTGA | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1113 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt6 | GGCGGGGTGTTATGAATCCACCGCGATCCGTTATGTTAGGCTGTAATCATTAAGCACTTTATGTGCACTCGTGGTATGCC | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1114 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt7 | AATTACTGGAGCTTGGCCGTAGGTAGAAAGATTTGCATTATACCTGGGGGGCTCTCTGGTTGTGTTTAATTGGTTACCCC | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1115 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt8 | ATGCTGCACTAGTTACCTTGCCTTTGCTTTCTTATTCTGCTCGTGCGTAAAAGTGGTTTTTCTTGCGTTGCGGGTGCTTG | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1116 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt9 | TGTTCGTTCGACTTCTCCGTCGTTTTTGTATTAACGTAGACCTTGGTTGAGCATGCTTACCTCTGCTTGGATTAATGACG | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1117 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt10 | TAAGGATCTTGGGTTCATGCCGCAACTGGGATGTTTGCTGCCTCCTTTATGGAGCTTAGCTGCGAGCGTTCTTGTTTGGT | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1118 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt11 | GTCTAAGTGCTTCTAGGCGGATTTGGCGCGTTCCGACGATTAGACTAGGACAACGATTCAGTGGTGTCGATGGTGTGTTC | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1119 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt12 | GGGGTAAGCCCGCGGCTCTCTCCTATGTATTCAGTGTACTCACGAAGATGTCCGTACTCCGTACGCTGCTATGCGTTCCC | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1120 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt13 | TCGGGGGCGCAGCTTGGGCCGTTGCTCCTGCCGGTCTCTGTGTGCGTGCGGTTCTCGCTCTTGTGGCTCCGTCCTTGGGG | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1126 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S1 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGCTGGTGGCCATTGGCTCGTGTCTCGTTACTGCCGAGTG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | Exhibited a linear concentration ranging from 2×10(1) to 2×10(5) CFU/mL and LOD of 20 CFU/mL. | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1127 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S2 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GGAATGACCTGGATTGACCCGTGAGTGTAGCATTTGTCCG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1128 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S3 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TTGACGATACGCAGGGGCGATACAGACAGTCTGCGTATTC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1129 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S4 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTGTATCCCTCCTCGCTTCCATACCCAAACCGGACACACC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1130 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S5 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTGCATGCACCTCACGCATCGAGCACTCACTCCTTCTACG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1131 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S6 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CCTCCCGAGGACACACACACACCATCGCGGTACTCTCCCG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1132 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S7 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GCGCACCTCCGCCCTGTCGGGCGTCGTTTCCCCACGAATC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1133 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S8 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GTTTCCGTATGCGCAGCGCCATACACCTGTCTGATCTCCCC-AGATAGTAAGTGCAATCT | 101 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1134 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S9 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGTCGCAAGGACTCGATCTGGTGGTACCTGCTTTCCGTTG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1135 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S10 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGAGCACCAAGGATAGTTAGCGGTCGCCTTCACACTAGGC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1136 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S11 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTGACAGATTAAAAGTGGTTGGGCAACTTCTGCTTGCGAA-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | 4.41 × 10(-12) M | Detection | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1137 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S12 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GGTGGTGTTGACAATTGAACCTTTGCAGGGGTCTGGTGGG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1138 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S13 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GTGGAGGTGCGCTATAGGTCTCTCCGGGTACTGATCCAAT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1139 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S14 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CCGACCCGTAACGCCAGTGAGGGAACACTCTGGAATAGTT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1140 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S15 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CGAGCAAACTGATAAACTCCGCCATGTCAGGCAAAGCTTT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1141 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S16 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTTCGTTCCGTTGACATAATTCAATTTTGCGTATTTCTTG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1142 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S17 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-ATGGGGCTAGTCTACTTCTGTGTCTACCTAGGATTCCGCT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1143 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S18 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGTAGGCGTAACCTCCTACTCTGTGCACTGTCTAAAGTGAC-AGATAGTAAGTGCAATCT | 101 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1144 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S19 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CGCGGCGTACGCTATCTTGTAACCTCCCGAACTATAACCAC-AGATAGTAAGTGCAATCT | 101 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1145 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S20 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CAAGCGACTCGACCGTGGTACCTCCCCAATAGCCATTTGA-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1146 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S21 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TCTCGCAGCCTCTTCCAATCTTGTTATTTACGCTTTCTGT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1147 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S22 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CACAAAGGAGCAAGAACTCAATTGCGCTCGTACCTTGTGG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1148 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S23 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GTAGCTGGGGTCCGGATCTGCGGTTCAGTGCGCTATTGTG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1149 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S24 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGACGGCTATCTCATTTGGCACATCATTTAGTAAGCTATC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | 3.75 ×10(-3) M | Detection | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled or 5′-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1183 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C5 | CCTAACCGATATCACACTCAC-GGCTAGCGGACAGGTGTAGGTCGGAATCCTTCAGCGTAGA-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1184 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C7 | CCTAACCGATATCACACTCAC-AGTATACCGCTCCACCAGTGTGATATCGGGATCTGCTGAC-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1185 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C10 | CCTAACCGATATCACACTCAC-GTAGTGAGGTGGGTCGTGAAGGGAGGCACTACTGGTGCGT-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1186 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C13 | CCTAACCGATATCACACTCAC-GAGGTGAGGGTGCGAGGGTAAGGGGGCAAACCTGGTGCGT-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1187 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C16 | CCTAACCGATATCACACTCAC-ACGTAGTGAGGGTTGCGAGGGTAAGGTGGTCAGTATACGC-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1203 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G1 | CAGGTCCATCGAGTGGTA-GGAGGTATTTAGTGCCAAGCCATCTCAAACGACGTCTGAG-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | 3.1 ± 1.2 nM | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1204 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G3 | CAGGTCCATCGAGTGGTA-TGCAGCGGACAGTGTGGGACCATCGCTGCGGATGTATGAA-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | 5.6 ± 2.4 nM | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1205 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G7 | CAGGTCCATCGAGTGGTA-CCCAACCCACGATGCGCAAGAGGAATGCAGCCTACCAGCA-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | 4.6 ± 1.6 nM | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1206 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G1-T1 | TAGGAGGAGGTATTTAGTGCCAAGCCATCTCAAACGACGTCTGAGTCGCACTGCTCCTG | 59 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | Achieved a detection limit of 1 nM. | 10 | Electrophoretic Mobility Shift Assay (EMSA) | 4.5 ± 2.2 nM | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1207 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G2 | CAGGTCCATCGAGTGGTA-CCGAGTTCCCAATATTATGGCTATGCAGGATACTTCACCT-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1208 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G4 | CAGGTCCATCGAGTGGTA-TGAGTACTAGTTCCCCAGGAGAAAGCAGATCCCCAGGTAC-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1209 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G5 | CAGGTCCATCGAGTGGTA-GCACAGGACGCAAGATGAATGCAGCATACCAGTCCCTAGA-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1210 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G6 | CAGGTCCATCGAGTGGTA-CAGCTGTCGACGCGTTACCGTGAACGGAACACCGATGACG-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1211 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G8 | CAGGTCCATCGAGTGGTA-TGCGTGATTGGACCAGGGAAAGATGCACCGCAAGACAAGA-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1212 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G9 | CAGGTCCATCGAGTGGTA-AGGATAATCCGATACGCAAGAAGAAAGCAGATTACCAGGA-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1213 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G10 | CAGGTCCATCGAGTGGTA-CAAAGTCGGCAAGGTGGAAAGCAGCCACACCACGACTAGT-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1226 | 31403764 | 2019 | Rapid Detection of Mycoplasma-Infected Cells by an ssDNA Aptamer Probe | Aptamer A15-1 | GTGGGGTTGAAAACGCCGGAGAGGGTGTGTGGGTGGGGTA | 40 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Mycoplasma-Infected Cells (Jeko-1 lymphoma cells) | Whole cell | Develop an aptamer probe for the rapid detection of mycoplasma-infected cells. | Mycoplasma-positive cells showed a strong signal, but no signal was detected in the mycoplasma-negative cells. | 15 | Flow Cytometry | 24.5 nM | Detection | Whole Cell-SELEX | 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1238 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp1 | AGTGTGCTCTTCTCAGGTCT-GTGGCCGGGGGCACTAATGCGGGCTATAAGTCTCCTTGGG-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | 35.60 ± 6.36 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1239 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp2 | AGTGTGCTCTTCTCAGGTCT-CCTATACCTGGCATCAGAGAGCTAGGGGCCACGGTTCGCA-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | 204.38 ± 97.31 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1240 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp3 | AGTGTGCTCTTCTCAGGTCT-GGTGCTGCGATGCTTTCTGGTGGTGTATGGTTGTCTTTTG-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1241 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp4 | AGTGTGCTCTTCTCAGGTCT-CGGCGCGGTTGTGGGTACCTAGGGTTGTTGTTGCTTCTCA-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | Hp4 had excellent binding to H pylori cells and almost no binding to E coli, S aureus, or V anguillarum. | N/A | Fluorescence Binding Assay | 26.48 ± 5.72 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1242 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp5 | AGTGTGCTCTTCTCAGGTCT-GGGCTGTGGGTCGGCACGTCGTCTCTTCATGGTTGTGGTG-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1243 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp6 | AGTGTGCTCTTCTCAGGTCT-TTAGGGACCCATGGGCTAACCCGGGCACAAGATTGTCTCA-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1244 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp7 | AGTGTGCTCTTCTCAGGTCT-ACACAACCTGCCGTATTGTAACCGTCGTCCCCCCGAAGCA-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1281 | 31718045 | 2019 | Aptamer Affinity-Bead Mediated Capture and Displacement of Gram-Negative Bacteria Using Acoustophoresis | GN6 aptamer | ATACCAGCTTATTCAATTGGGTGAGGGGGGGTTCACAACGTTAAAGATAGACGGGGGAAGATAGTAAGTGCAATCT | 76 | N/A | ssDNA | Gram-negative Bacteria | Whole cell | Develop aptamer-modified microbeads and an acoustophoresis method for capturing and displacing gram-negative bacteria. | It achieved high recovery (up to 98%) and high purity (up to 99.5%). | N/A | N/A | N/A | Detection | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1282 | 31511614 | 2019 | Detection of Gram-negative bacterial outer membrane vesicles using DNA aptamers | GN6 | ATACCAGCTTATTCAATT-GGGTGAGGGGGGGTTCACAACGTTAAAGATAGACGGGGGA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Gram-negative Bacteria (Escherichia Coli (E. Coli) DH5α, Escherichia Coli (E. Coli) K12, and Serratia Marcescens) | Whole cell | Isolated aptamers against multiple Gram-negative bacterial species and developed an aptamer-based detection tool (ELAA) towards bacterial secretory cargo released from the outer membranes of Gram-negative bacteria. | Can detect as low as 25 ng/mL of bacterial OMVs, and dissociation constants of GN6 to OMVs derived from E. coli DH5α, E. coli K12 and S. marcescens were 0.13 ± 0.01 μg/ml, 3.70 ± 0.98 μg/ml and 0.23 ± 0.16 μg/ml, respectively. | 12 | Fluorescence Binding Assay | 29.94 ± 2.49 nM (for E. coli DH5α), 59.70 ± 10.89 nM (for E. coli K12) and 38.98 ± 6.46 nM (for S. marcescens) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 5'-Biotinylated and 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1283 | 31511614 | 2019 | Detection of Gram-negative bacterial outer membrane vesicles using DNA aptamers | GN12 | ATACCAGCTTATTCAATT-CCGAGTCCAGACTCACCGCCGCCTCCTCAAGACGTGCTGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Gram-negative Bacteria (Escherichia Coli (E. Coli) DH5α, Escherichia Coli (E. Coli) K12, and Serratia Marcescens) | Whole cell | Isolated aptamers against multiple Gram-negative bacterial species and developed an aptamer-based detection tool towards bacterial secretory cargo released from the outer membranes of Gram-negative bacteria. | GN12 was 3.6 times higher in binding to 10(8) cells of Gram-negative bacteria than to Gram-positive bacteria tested. | 12 | Fluorescence Binding Assay | 20.36 ± 2.38 nM (for E. coli DH5α), 24.80 ± 3.98 nM (for E. coli K12) and 53.83 ± 17.70 nM (for S. marcescens) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1284 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA1 | GACGCTTACTCAGGTGTGACTCG-TCCATACCTCCTATTCCTATCTGATCACCATGAGCTCTCGCCTGAACTGG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1285 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA2 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | VA2 could recognize different V. alginolyticus prevalent in Beibu Gulf with high specificity and affinity. | 9 | Flow Cytometry | 14.31 ± 4.26 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | No cytotoxic effects shown in vitro and in vivo. | N/A | Best Candidate | N/A | N/A |
| ABdb_1286 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA3 | GACGCTTACTCAGGTGTGACTCG-TATCTTGTCAGCATATAGCCGCCCTGTCTCGTGCCTCTAATTGGGCTTGT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1287 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA4 | GACGCTTACTCAGGTGTGACTCG-CTTGGTGGGGGGTGGCGGGTTGGTGATTAGTTGCGTGTACAACCGTTGCG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1288 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA5 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1289 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA6 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1290 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA7 | GACGCTTACTCAGGTGTGACTCG-GGGGCACTCTGGGGAAGGACGTAAGCGATAGCCGACCTCGTGGAATATTA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1291 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA8 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | VA8 could recognize different V. alginolyticus prevalent in Beibu Gulf with high specificity and affinity but less potent than VA2. | 9 | Flow Cytometry | 90.00 ± 13.51 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | No cytotoxic effects shown in vitro and in vivo. | N/A | Best Candidate | N/A | N/A |
| ABdb_1292 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA9 | GACGCTTACTCAGGTGTGACTCG-TCACCGTCATACACGGTCACCTGTTCTGCTATCACCCTGACGTGATTGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1293 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA10 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1294 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA11 | GACGCTTACTCAGGTGTGACTCG-TGGCGCAAGGGAAGGTGTTGGGGGATGGTTGGTGGGGTGTGTGGTTGTAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1295 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA12 | GACGCTTACTCAGGTGTGACTCG-ATGGCTGACTATATAAGAGAACGGGGGCTGCGGTGGTCCCGATCTGGCAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1296 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA13 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1297 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA14 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1298 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA15 | GACGCTTACTCAGGTGTGACTCG-TGGCGATGTACGCACCGCCCTCAGACTCATTCAGCATATAGCCTAGTAAC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1299 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA16 | GACGCTTACTCAGGTGTGACTCG-GGGGTGGATTGGGTGGGGTGGTTGGTTCGTTTTAAAGTACTGTGTAAGCG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1300 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA17 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1301 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA18 | GACGCTTACTCAGGTGTGACTCG-GCTGCGTTAACATATAGGGCATTTGAGTGCGCGCATAGGGTTGTGGCGAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1302 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA19 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1303 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA20 | GACGCTTACTCAGGTGTGACTCG-TCCAGTCAGTATATAACTCCTCGACCCTGTGATCGGCTACGGTGGCAGTA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1304 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA21 | GACGCTTACTCAGGTGTGACTCG-GAGTGCTCGGTTGGTGTTGGGGGAGGGTGGTGGGTGACCATGCTACATGT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1305 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA22 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1306 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA23 | GACGCTTACTCAGGTGTGACTCG-GGGCGGGTGGACGGGGGTGGTATGGAGGTTGGAGTAAGCGGTTTCACCGA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1307 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA24 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1308 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA25 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1309 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA26 | GACGCTTACTCAGGTGTGACTCG-TCTGGTAGCATATAGCCGGCAGAGCACGGTCCCCTCATGGTTGGCACGTA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1310 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA27 | GACGCTTACTCAGGTGTGACTCG-GCCATGCTCACTATATAAGATATGTAAGTTGGACTACATATGTATGGCTG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1311 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA28 | GACGCTTACTCAGGTGTGACTCG-GCTGTGATCGTATGGACGCTGCAGTTGGATGACGCTATGAGGTATTCCAA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1312 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA29 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1313 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA30 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1314 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA31 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1315 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA32 | GACGCTTACTCAGGTGTGACTCG-CACTATTGTCAAGTCACGAGTTAGGTACCTATGTGATCTGAGGTATCAA-CGAAGGACGCAGATGAAGTCTC | 94 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1316 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA33 | GACGCTTACTCAGGTGTGACTCG-CTACTCAGGTGACCCTCAAACGTATCTAGTTTGGCAGCGAGGTTCCTTCG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1317 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA34 | GACGCTTACTCAGGTGTGACTCG-TTGCGAATATAGCGACGAGTATCGTCAGAGTCGCCGGGTCCAGGTTCGA-CGAAGGACGCAGATGAAGTCTC | 94 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1318 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA35 | GACGCTTACTCAGGTGTGACTCG-GGTGGTGGGGATTTGGGGTGGTTGGTTCATCTATCTGGTCGTTACCGGGG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1319 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA36 | GACGCTTACTCAGGTGTGACTCG-CGCGGCACCAGCACGACGGTTCGATTGGCTGCGGAAACCACGCACTGCAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1320 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA37 | GACGCTTACTCAGGTGTGACTCG-GGTGTTGGTGGGTGGCGGGGTGGTGGTTGGTGTTCCCGAACCTGATGAAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1321 | 31563315 | 2019 | Rapid identification and quantitation of the viable cells of Lactobacillus casei in fermented dairy products using an aptamer-based strategy powered by a novel cell-SELEX protocol | Apt-1 | ATCGTATACCTAGAAGATATGACCGGCAGTTGATGAGATAGAGGCGCTGGTGGGTAGATA | 60 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Lactobacillus Casei (ATCC 393) | Whole cell | An aptamer-based strategy using PEG and chitosan-modified graphene oxide, with complementary ring-mediated RCA, was developed for qualitative and quantitative detection of viable L. casei in dairy products. | N/A | 8 | Flow Cytometry | 21.1 ± 2.7 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1322 | 31563315 | 2019 | Rapid identification and quantitation of the viable cells of Lactobacillus casei in fermented dairy products using an aptamer-based strategy powered by a novel cell-SELEX protocol | Apt-2 | GGCTCACCTACAGGCTGCGGAGTCATAGCATCGTGACAGAGTCGAGTGTCGACTATACGT | 60 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Lactobacillus Casei (ATCC 393) | Whole cell | An aptamer-based strategy using PEG and chitosan-modified graphene oxide, with complementary ring-mediated RCA, was developed for qualitative and quantitative detection of viable L. casei in dairy products. | Achieved a detection limit of 10(5) cfu/mL and selective detection of L. casei in commercial dairy drinks, with a dynamic range of 10(5) to 10(9) cfu/mL. | 8 | Flow Cytometry | 19.3 ± 3.7 nM | Detection | Whole Cell-SELEX | 3'-Biotinylated (biotin-AAAAAAAAAA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1323 | 31563315 | 2019 | Rapid identification and quantitation of the viable cells of Lactobacillus casei in fermented dairy products using an aptamer-based strategy powered by a novel cell-SELEX protocol | Apt-3 | TCGAAGTGAGCGCGCGGTGTGGTGACTGTGTTGCAGATGGATGCATGGAGGTGATGATGA | 60 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Lactobacillus Casei (ATCC 393) | Whole cell | An aptamer-based strategy using PEG and chitosan-modified graphene oxide, with complementary ring-mediated RCA, was developed for qualitative and quantitative detection of viable L. casei in dairy products. | Achieved a detection limit of 10(5) cfu/mL and selective detection of L. casei in commercial dairy drinks, with a dynamic range of 10(5) to 10(9) cfu/mL. | 8 | Flow Cytometry | 15.6 ± 4.1 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1341 | https://doi.org/10.1016/j.snb.2018.12.112 | 2019 | Screening of highly-specific aptamers and their applications in paper-based microfluidic chips for rapid diagnosis of multiple bacteria | A1 | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | 5'-GGCAGGAAGACAAACA-N40-TGGTCTGTGGTGCTGT-3' | ssDNA | Acinetobacter Baumannii | Whole cell | Identify aptamers and develop a dual-aptamer, NC-based microfluidic chip for fast diagnosis of three common nosocomial bacteria. | LOD was estimated to be 10(3) for AB. | 3 | Fluorescence Spectroscopy | 6.8 ± 1.9 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1342 | https://doi.org/10.1016/j.snb.2018.12.112 | 2019 | Screening of highly-specific aptamers and their applications in paper-based microfluidic chips for rapid diagnosis of multiple bacteria | E27 | ACAGCACCACAGACCACAGATCATACCAGTGCGGCCGTTAGCCTCGTTAATCTGGCGTTTGTCTTCCTGCC | 71 | 5'-GGCAGGAAGACAAACA-N40-TGGTCTGTGGTGCTGT-3' | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Identify aptamers and develop a dual-aptamer, NC-based microfluidic chip for fast diagnosis of three common nosocomial bacteria. | LOD was estimated to be 10(4) for EC. | 3 | Fluorescence Spectroscopy | 11.9 ± 3.7 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1343 | https://doi.org/10.1016/j.snb.2018.12.112 | 2019 | Screening of highly-specific aptamers and their applications in paper-based microfluidic chips for rapid diagnosis of multiple bacteria | O28 | GGGGAAGACAAACACCTCATAGTCGGTATCGGCCGTTTGGGCGTTTTTCCGATGGTCTGTGGTGCTGT | 68 | 5'-GGCAGGAAGACAAACA-N40-TGGTCTGTGGTGCTGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers and develop a dual-aptamer, NC-based microfluidic chip for fast diagnosis of three common nosocomial bacteria. | LOD was estimated to be 10(5) CFU/μL for MRSA. | 3 | Fluorescence Spectroscopy | 199.6 ± 35.8 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1357 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20–5 | GCAATGGTACGGTACTTCC-ATTTCGCCCCCGTGTTCCGACTGGTATCTTCACGTCTTCGAGTGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 3.9 ± 0.6 nM | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1358 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20–7 | GCAATGGTACGGTACTTCC-CGCAATACCAAAGTGGCGAGAGCGCTGTCTTGAGTGAGTGGTTGG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 8 ± 0.9 nM | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1359 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20–10 | GCAATGGTACGGTACTTCC-TATGGCGTGGCAAGCTTGGCCCGCTTCTCAAGCATGGTTATCTAC-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 10.1 ± 1.7 nM | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1360 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-1 | GCAATGGTACGGTACTTCC-GATTAGCTACATTTGGTTGTTTACCGCTCTGCTTTCTATTATTT-CAAAAGTGCACGCTACTTTGCTAA | 87 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1361 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-2 | GCAATGGTACGGTACTTCC-TGTTAGTGTTTAAGGCCCAAAGTCGGTTCATCAGTACATTCCTCG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1362 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-3 | GCAATGGTACGGTACTTCC-TTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAA-CAAAAGTGCACGCTACTTTGCTAA | 85 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1363 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-4 | GCAATGGTACGGTACTTCC-GATTGTGGTGGGGCCTCGAGATACCTGCGACCGGCATACTTGAAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1364 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-6 | GCAATGGTACGGTACTTCC-TTGCCCGTACACTGTCATCCTCGGCTTATAGCCATTATTGAAATT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1365 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-8 | GCAATGGTACGGTACTTCC-GGGCCTATACAGGCTTTTACTTCTGAGTTTGGTAGTTTCTTCGGA-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1366 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-9 | GCAATGGTACGGTACTTCC-GCGAGGGCCAACGGTGGTTACGTCGCTACGGCGCTACTGGTTGAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1381 | 32289369 | 2020 | Accurate MRSA identification through dual-functional aptamer and CRISPR-Cas12a assisted rolling circle amplification | Apt A | ATATACACCCCACCTCGCTCCCGTGACACTAATGCTATTTTTT | 43 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 17802) | Staphylococcus aureus Protein A (SpA) | Dual-functional technology based on aptamer and CRISPR-Cas12a-assisted RCA for detection of MRSA. | Fluorescence intensity shows a linear correlation with the logarithm of MRSA concentration, ranging from 10(6) to 10(2) CFU/mL, spanning six orders of magnitude. | N/A | N/A | N/A | Detection | N/A | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1382 | 32289369 | 2020 | Accurate MRSA identification through dual-functional aptamer and CRISPR-Cas12a assisted rolling circle amplification | Apt B | CACCCCACCTCGCTCCCGTGACACTAATGCTATTTTTT | 38 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 17802) | Penicillin binding protein 2a (PBP2a) | Dual-functional technology based on aptamer and CRISPR-Cas12a-assisted RCA for detection of MRSA. | Fluorescence intensity shows a linear correlation with the logarithm of MRSA concentration, ranging from 10(6) to 10(2) CFU/mL, spanning six orders of magnitude. | N/A | N/A | N/A | Detection | N/A | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1386 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF501 | TAGGGAAGAGAAGGACATATGAT-TTTCTCAACGGGACCATCACTTACCTCAAGTACTTGGACG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1387 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF502 | TAGGGAAGAGAAGGACATATGAT-CCGGCTATCTCCCTACCGTGGCCGAGTACCTCAAACGTTT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1388 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF503 | TAGGGAAGAGAAGGACATATGAT-GTCAACTCATTTATGGTGCTCCTCGTACCTCAGGTGGTTA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1389 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF504 | TAGGGAAGAGAAGGACATATGAT-GGCCATACCTCGTGCCTTCTGTGATCATCTCTATCAATTG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1390 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF505 | TAGGGAAGAGAAGGACATATGAT-CCTCTCTCTTACTGCTACTGGGCAGGGTACTCAATTACGT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1391 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF506 | TAGGGAAGAGAAGGACATATGAT-CGGTCCCGACTCAATATTGTTCCCTCCCCTTATCAGGCGG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1392 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF507 | TAGGGAAGAGAAGGACATATGAT-TCCTCTAATCAACTCTATGCCTTATCCCCTTGGTCAGGAC-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1393 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF508 | TAGGGAAGAGAAGGACATATGAT-ACTGGCCTTGACACCCTGTTGTGGCTTGATGACAATAACA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | EF508 exhibited more than 20- to 800-fold higher binding to E. faecalis target cells than to non-target cells. | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 37 ± 4 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1394 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF509 | TAGGGAAGAGAAGGACATATGAT-CCTCACTCTTGACCCAAAGTGCATGCTCTATTCATTCGGA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1395 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF510 | TAGGGAAGAGAAGGACATATGAT-GCTTCTGTGCACATTAAGGCACTCGTCTTCACTGTGGTTC-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1396 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF511 | TAGGGAAGAGAAGGACATATGAT-CCTAACTCACTTACCAGCACGAGGTGCCTGTACCATCAAT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1397 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF512 | TAGGGAAGAGAAGGACATATGAT-CTCTCATCACAGGAATTTGAATTTCCCTTGTGGACAGTAA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1398 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF513 | TAGGGAAGAGAAGGACATATGAT-GATGTGAATTCCGTCCCTTGGTCAGACACTTCAACACCGG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1399 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF514 | TAGGGAAGAGAAGGACATATGAT-TCTCGACGCTATGATCAAGACGCAGTATGATGGCACATCA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1400 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF515 | TAGGGAAGAGAAGGACATATGAT-TTAACCCTCATTTAATGGCCGCGTCAATCCGCAAAGGGTC-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1401 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF516 | TAGGGAAGAGAAGGACATATGAT-TTCCTTCGCAGGACACCGATGGCCAGGCGCGAGTCAATAT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1441 | 32471128 | 2020 | Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell Culture | A15-1 | GTGGGGTTGAAAACGCCGGAGAGGGTGTGTGGGTGGGGTA | 40 | N/A | ssDNA | Mycoplasma Hyorhinis | Mycoplasma hyorhinis-infected cells | Develop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines. | A15-1 could bind to M. hyorhinis, and mixed mycoplasma-infected cells were detectable within 30 min. | N/A | Flow Cytometry | N/A | Detection | N/A | 5'-Biotinylated and Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1442 | 32471128 | 2020 | Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell Culture | A16-1Y | TGGGTGGGGTTGTCGCTAGGGGTTTAAGGGGTCGTCGTGA | 40 | N/A | ssDNA | Mycoplasma Hyorhinis | Mycoplasma hyorhinis-infected cells | Develop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines. | A16-1Y could bind to M. hyorhinis and mixed mycoplasma-infected cells. | N/A | Flow Cytometry | N/A | Detection | N/A | 5'-Biotinylated and Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1443 | 32471128 | 2020 | Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell Culture | #1J | ATCCAGAGTGACGCAGCAGCCAACGTGCTTTCTACCTTATTTTCCGTCACTCTCACTCTGGACACGGTGGCTTAGT | 76 | N/A | ssDNA | Mycoplasma Hyorhinis | Mycoplasma hyorhinis-infected cells | Develop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines. | #1J could bind to unclassified mycoplasma-infected cells, but not M. hyorhinis-infected cells. | N/A | Flow Cytometry | N/A | Detection | N/A | 5'-Biotinylated and Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1444 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.01 (ID 5) | TTTTTAAGCCCACAGACGWYCGGCAGGCACAGTYYGTCAAGGXCGYGCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | W = indole‐dU,Y = phenol‐dU,X = amine‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1445 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.02 (ID 6) | TTTTTAAGCCCACCYCGCYGTGCAAGGCGAACGCCATCAGTGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | Y = phenol‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1446 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.03 (ID 7) | TTTTTAAGCCCACCYCCGWYCGAAGGCCACAGCYCATGCGCGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | Y = phenol‐dU,W = indole‐dU, five additional Ts at the 5'-end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1447 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.04 (ID 8) | TTTTTAACACGACCCCACYGTGCGAGCCGAACACCACCACGGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | Y = phenol‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1448 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.05 (ID 9) | TTTTTAACACGACXYAGCYGTGWGGGCCGAACACCAGGCACGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | X = amine‐dU,Y = phenol‐dU, five additional Ts at the 5'‐end, and CCATG at the 3′‐end, five additional Ts at the 5′‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1449 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.06 (ID 12) | TTTTTAACACGACAGCAGWYCGGCGGGCACAGTGCGTGCGAGXCGYGCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | Aptamer ID 12 showed specific binding to Vp. | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | W = indole‐dU,Y = phenol‐dU,X = amine‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1450 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.07 (ID 13) | TTTTTAACACGACCAWACYGTGGCAGACGAACGCCGTCACAGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | Y = phenol‐dU,W = indole‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1451 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.08 (ID 14) | TTTTTAAGCCCACGCGGCYGTGAGXCGCACAGCCAWAGCACGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | W = indole‐dU,Y = phenol‐dU,X = amine‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1452 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.09 (ID 15) | GCCCACTGAACTGTGGCGGGCACAGGATGTGGAAGTGGGC | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1462 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA1 | CTGCGATCAAGTTACGCACCTCGCCATGTTCCCCGCCCGGCATGTGTTATGCCCCTGTG | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | C. jejuni can be detected from 1.7 × 10(1) to 1.7 × 10(6) CFU/mL. The limit of detection (LOD) is obtained as 10 CFU/mL in PBS and 13 CFU/mL in contaminated milk samples. | 12 | Fluorescence Binding Assay | 1.37 ± 0.28 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1463 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA2 | GTTGGGTGCGGCGGGAGGGTCCCATCGGAAACCAAGCTGTGCTGAGATTTTTCCGCGAT | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 1.78 ± 0.88 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1464 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA3 | CACGCAAGTTAATCAGCGTGACATCAGGTCTAGATTCCGGCTTATAGCGCCAGGTTTCC | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 2.01 ± 0.90 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1465 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA4 | GGTGGGCTCTGTTCGGGAGGGGTATTGTTAGGACCGAGAGGCTGCATTCCGCCAGCTGC | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 2.26 ± 0.91 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1466 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA5 | GCTCTGTCTTTTCAGCTTTATCCGGGTGTGGTGGGGGGGGGATTTGCTTGGTCGGTTCT | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 3.53 ± 1.38 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1470 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx1.1) | ATCCAGAGTGACGCAGCA-GTAGTTTGTTGGTTATTACGGCGGGTTGCGATGGGTGCGAATCGG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx1 (Stx1.1) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | LOD of 44.5 pg/mL for stx1 with minimal cross-reactivity and a dynamic response range from 50 pg/mL to 100 ng/mL. | 7 | Bio-Layer Interferometry (BLI) | 8.27 nM (of peptide) and 47.2 pM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1471 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx1.3) | ATCCAGAGTGACGCAGCA-GGATAGGACGTCAAATTAGGGCCCGGTACAACGAAAGCCCACAAC-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx1 (Stx1.2) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | N/A | 7 | Bio-Layer Interferometry (BLI) | 31.0 nM (of peptide) and 30.3 μΜ (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1472 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx2.1) | ATCCAGAGTGACGCAGCA-GGGGGCAGGTTCATGGCTTGGGTGCGGTGGGCATGATTCGTGGTG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx2 (Stx2.1) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | N/A | 7 | Bio-Layer Interferometry (BLI) | 45.2 nM (of peptide) and 83.8 nM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1473 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx2.2) | ATCCAGAGTGACGCAGCA-TGTATCTCTTACTTAAGCCTTTGGTTCGGTAACAGCCTGGCATGC-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx2 (Stx2.2) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | N/A | 7 | Bio-Layer Interferometry (BLI) | 110 nM (of peptide) and 25.2 μM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1474 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx2.3) | ATCCAGAGTGACGCAGCA-GGAAAGGACGTCAAATTAGGGGCCGGGACAACGAAAGCCCACAAC-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx2 (Stx2.3) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | LOD of 41.3 pg/mL for stx2 with minimal cross-reactivity and a dynamic response range from 50 pg/mL to 100 ng/mL. | 7 | Bio-Layer Interferometry (BLI) | 4.6 nM (of peptide) and 28.6 pM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1487 | 32347530 | 2020 | A sensitive and rapid bacterial antibiotic susceptibility test method by surface enhanced Raman spectroscopy | E. coli O157:H7 aptamer | GCAATGGTACGGTACTTCCCGCAGTTTGGGAAGGGTGATCGCACTATCAGAGGATTCCGTTCGGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (CICC: 21530) | Whole cell | Developed a rapid antibiotic susceptibility test (AST) method and determined the MIC value by the Bacteria-aptamer@AgNPs-SERS method. | When treated with 2(−3) μg/mL tigecycline for 1 h, the Raman peak intensity of E. coli O157: H7 was 882 a.u., and when the concentration of antibiotics was sub-MIC (2(−4) and 2(−5) μg/mL), the peak value of 735 cm−1 increased, and the Raman intensity was 3382 a.u. and 4213 a.u. | N/A | N/A | N/A | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1488 | 32347530 | 2020 | A sensitive and rapid bacterial antibiotic susceptibility test method by surface enhanced Raman spectroscopy | S. aureus aptamer | TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 21600) | Whole cell | Developed a rapid antibiotic susceptibility test (AST) method and determined the MIC value by the Bacteria-aptamer@AgNPs-SERS method. | When treated with 2(−1) μg/mL vancomycin for 1 h, the Raman peak intensity of S. aureus was 556 a.u., and when the concentration of antibiotics was sub-MIC (2(−2) and 2(−3) μg/mL), the peak value of 735 cm−1 increased, and the Raman intensity was 2177 a.u. and 2903 a.u. | N/A | N/A | N/A | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1490 | 35516186 | 2020 | Selection of potential aptamers for specific growth stage detection of Yersinia enterocolitica | M1 | AGCAGCACAGAGGTCAGATGATATAACCTTAATAAATAAAATATAAATTATTTAATCTTACCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-TTCACGGTAGCACGCATAGG-3' | ssDNA | Yersinia Enterocolitica (CICC 21669) | Whole cell | Identified aptamers bound to the different growth stages of Y. enterocolitica. | Showed good affinity to all different stages of bacteria (adjustment phase, log phase, and pre-stationary phase). | 10 | Flow Cytometry | 37.93 ± 7.88 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1491 | 35516186 | 2020 | Selection of potential aptamers for specific growth stage detection of Yersinia enterocolitica | M5 | AGCAGCACAGAGGTCAGATGCTTGGTTCCACCGTACTGACTGTAGTAAAATCTGATCACTCCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-TTCACGGTAGCACGCATAGG-3' | ssDNA | Yersinia Enterocolitica (CICC 21669) | Whole cell | Identified aptamers bound to the different growth stages of Y. enterocolitica. | Showed good affinity to all different stages of bacteria (adjustment phase, log phase, and pre-stationary phase). | 10 | Flow Cytometry | 74.96 ± 21.34 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1492 | 35516186 | 2020 | Selection of potential aptamers for specific growth stage detection of Yersinia enterocolitica | M7 | AGCAGCACAGAGGTCAGATGTAGTCGGTCTTCTTGTTTGAAACTGCTAATTTTGAAAAAACCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-TTCACGGTAGCACGCATAGG-3' | ssDNA | Yersinia Enterocolitica (CICC 21669) | Whole cell | Identified aptamers bound to the different growth stages of Y. enterocolitica. | Showed good affinity to all different stages of bacteria (adjustment phase, log phase, and pre-stationary phase). | 10 | Flow Cytometry | 73.02 ± 18.76 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1494 | 32994896 | 2020 | Aptamer-nanobody based ELASA for detection of Vibrio cholerae O1 | V.ch27 | GCCTGTTGTGAGCCTCCTAAC-GGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCAC-CATGCTTATTCTTGTCTCC | 81 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Vibrio Cholerae O1 [Inaba (ATCC 39315) and Ogawa] | Whole cell | Identify aptamers and develop aptamer-nanobody-based ELISA for V. cholerae O1 detection. | The binding efficiency for V.ch27 was 53.3%. | 12 | Flow Cytometry | 20.186 ± 3.655 pM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1495 | 32994896 | 2020 | Aptamer-nanobody based ELASA for detection of Vibrio cholerae O2 | V.ch47 | GCCTGTTGTGAGCCTCCTAAC-CGTATTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTC-CATGCTTATTCTTGTCTCC | 79 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Vibrio Cholerae O1 [Inaba (ATCC 39315) and Ogawa] | Whole cell | Identify aptamers and develop aptamer-nanobody-based ELISA for V. cholerae O1 detection. | Identify 10(4) CFU/ml with 25 pM of biotinylated aptamer and only 20 μg/ml of VHH without any cross-reactivity. | 12 | Flow Cytometry | 15.404 ± 4.776 pM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1552 | https://doi.org/10.1016/j.microc.2021.106388 | 2021 | Rapid and sensitive determination of Pseudomonas aeruginosa by using a glassy carbon electrode modified with gold nanoparticles and aptamer-imprinted polydopamine | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Develop an electrochemical sensor based on a combination of aptasensing and molecular imprinting employing GCE/AuNP/Aptamer-MIP for ultrasensitive detection of P. aeruginosa. | Exhibited a wide linear dynamic concentration range of 10(1) to 10(7) CFU/ml with a low detection limit of 1 CFU/ml. | N/A | N/A | N/A | Detection | N/A | 5'-Amidation (NH₂) | N/A | The GCE/AuNP/Aptamer-MIP aptasensor signal remained unchanged, and only a 3% decrease in the peak current occurred after 50 repetitive cycles. | N/A | N/A | N/A |
| ABdb_1570 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI05 | TAGCTCACTCATTAGGCACGACTCACTCTTGAAGGGGTGAGGCATGGTGGTATCAGCATAGTTAAGCCAGCC | 72 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 144.4 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1571 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI08 | TAGCTCACTCATTAGGCACATGCACCGAGGTCAGAAGTGCCTGTAATACACACCCCTCGGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 301.4 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1572 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI 9 | TAGCTCACTCATTAGGCACCGAGTGCAAGATGTCCTACCCGATGAAGTAGGTTGGGTCTGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 279.7 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1573 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI23 | TAGCTCACTCATTAGGCACCTTGGCTTAAAATGATAGCTAGTGGCAGATTGTTAATTTGGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | The assay is able to detect 10(2) CFU/mL cells. | 10 | Flow Cytometry | 231.2 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1574 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI27 | TAGCTCACTCATTAGGCACATGGCAAGGTTGCCTTTTTGAGCGCGCTGCATAGTTAAGCCAGCC | 64 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 328.9 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1575 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI31 | TAGCTCACTCATTAGGCACCAGCCGGAAGGACCAGCTAGCTCACTCATTAGGCACCGAAGTGTGGTGCATAGTTAAGCCAGCC | 83 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 186.1 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1576 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI37 | TAGCTCACTCATTAGGCACGAACGGGCTTGTCTTTCCATAATTCGTGCGAAAGTGCCGCATAGTTAAGCCAGCC | 74 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 176.7 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1577 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI42 | TAGCTCACTCATTAGGCACTAGCGGAAGCTTAGTGTAAACGAGTGATAATGTGTTATGTGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 173.6 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1607 | 35846753 | 2022 | Selection and Identification of a DNA Aptamer for Multidrug-Resistant Acinetobacter baumannii Using an In-House Cell-SELEX Methodology | A01 | CAGGGGACGCACCAAGG-TTTTGTTTTTTCTTTGCTTCTTTTTGCTTTTTTTT-CCATGACCCGCGTGCTGCGTGA | 74 | 5'-CAGGGGACGCACCAAGG-N35-CCATGACCCGCGTGCTGCGTGAT-3' | ssDNA | Multidrug-resistant (MDR) Acinetobacter Baumannii | Whole cell | Identify aptamers against MDR A. baumannii. | Preferential binding to A. baumannii over other species. 25% of positive events for A. baumannii above the 12.66% of the negative control. | 7 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | Aptamer binding does not seem to interfere with the A. baumannii cell growth even after 24h (5.88E+02 x 1.45E+03; p=0.700). | N/A | N/A | N/A | N/A |
| ABdb_1673 | 35700936 | 2022 | SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers | EC1 | GGGGTCATAGTATCCTAGTTG-AATGATGACATTCCGAGGTACCCAGAGTGCGATACTAACCGGCCTGCTTG-CCTGTAATTTATCTTCTGGAGCT | 94 | 5'-GGGGTCATAGTATCCTAGTTG-N50-CCTGTAATTTATCTTCTGGAGCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 25922) | Lipopolysaccharide (LPS) | Identify aptamers that bind to LPS on Gram-negative bacteria and inhibit the LPS-induced inflammatory response, thereby inhibiting bacterial infections. | When aptamers bind to the LPS, the macrophage polarization ability of LPS can decrease, and the secreted nitrite level diminishes. | 8 | Flow Cytometry | 1.165 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1674 | 35700936 | 2022 | SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers | EC2 | GGGGTCATAGTATCCTAGTTG-CTCGCGCGCCCAATGTTTGCATCGATCTGATGGGCATAACGGCCTTGAAT-CCTGTAATTTATCTTCTGGAGCT | 94 | 5'-GGGGTCATAGTATCCTAGTTG-N50-CCTGTAATTTATCTTCTGGAGCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 25922) | Lipopolysaccharide (LPS) | Identify aptamers that bind to LPS on Gram-negative bacteria and inhibit the LPS-induced inflammatory response, thereby inhibiting bacterial infections. | When aptamers bind to the LPS, the macrophage polarization ability of LPS can decrease, and the secreted nitrite level diminishes. | 8 | Flow Cytometry | 10.26 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1675 | 35700936 | 2022 | SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers | EC3 | GGGGTCATAGTATCCTAGTTG-CCGACGAGACTTCCACAACGCTGCCAAGCCATCGTCCCCCCGCACTCAGG-CCTGTAATTTATCTTCTGGAGCT | 94 | 5'-GGGGTCATAGTATCCTAGTTG-N50-CCTGTAATTTATCTTCTGGAGCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 25922) | Lipopolysaccharide (LPS) | Identify aptamers that bind to LPS on Gram-negative bacteria and inhibit the LPS-induced inflammatory response, thereby inhibiting bacterial infections. | When aptamers bind to the LPS, the macrophage polarization ability of LPS can decrease, and the secreted nitrite level diminishes. | 8 | Flow Cytometry | 3.17 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1676 | 35700936 | 2022 | SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers | LM1 | GGGGTCATAGTATCCTAGTTG-CCGCCCGTAGAGGATTGTAGCCGCCTTTCGCCAACCTAAACCGAGACCTG-CCTGTAATTTATCTTCTGGAGCT | 94 | 5'-GGGGTCATAGTATCCTAGTTG-N50-CCTGTAATTTATCTTCTGGAGCT-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Lipopolysaccharide (LPS) | Identify aptamers that bind to LPS on Gram-negative bacteria and inhibit the LPS-induced inflammatory response, thereby inhibiting bacterial infections. | When aptamers bind to the LPS, the macrophage polarization ability of LPS can decrease, and the secreted nitrite level diminishes. | 8 | Flow Cytometry | 38.3 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1677 | 35700936 | 2022 | SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers | LM2 | GGGGTCATAGTATCCTAGTTG-TCGTTCATCTGAGCTCCTGGTATCGCGTGTGTATACGAGCCTCACATTCA-CCTGTAATTTATCTTCTGGAGCT | 94 | 5'-GGGGTCATAGTATCCTAGTTG-N50-CCTGTAATTTATCTTCTGGAGCT-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Lipopolysaccharide (LPS) | Identify aptamers that bind to LPS on Gram-negative bacteria and inhibit the LPS-induced inflammatory response, thereby inhibiting bacterial infections. | When aptamers bind to the LPS, the macrophage polarization ability of LPS can decrease, and the secreted nitrite level diminishes. | 8 | Flow Cytometry | 9.03 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1678 | 35700936 | 2022 | SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers | LM3 | GGGGTCATAGTATCCTAGTTG-CCGTCCCGGTAGTCTGAGCTTACAATGTCTGATTGGAAATGCACACCAAG-CCTGTAATTTATCTTCTGGAGCT | 94 | 5'-GGGGTCATAGTATCCTAGTTG-N50-CCTGTAATTTATCTTCTGGAGCT-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Lipopolysaccharide (LPS) | Identify aptamers that bind to LPS on Gram-negative bacteria and inhibit the LPS-induced inflammatory response, thereby inhibiting bacterial infections. | When aptamers bind to the LPS, the macrophage polarization ability of LPS can decrease, and the secreted nitrite level diminishes. | 8 | Flow Cytometry | 8.89 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1680 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K3 | CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 36,70 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1681 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K4 | CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1682 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K6 | CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K6 has the highest binding affinity to S. aureus BPA-12. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 17,01 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1683 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K13 | CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 60,69 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1684 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K15 | CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 20,90 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1685 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K20 | CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1686 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K3 | CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 28,06 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1687 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K4 | CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1688 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K6 | CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 31,99 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1689 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K13 | CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K13 and S15K15 have high binding affinity to E. coli EPEC 4. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 5,21 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1690 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K15 | CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K13 and S15K15 have high binding affinity to E. coli EPEC 4. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 8,89 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1691 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K20 | CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1692 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K3 | CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K3 and S15K13 have a high binding affinity for S. agalactiae. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 6,84 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1693 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K4 | CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1694 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K6 | CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 20,79 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1695 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K13 | CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K3 and S15K13 have a high binding affinity for S. agalactiae. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 6,53 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1696 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K15 | CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 45,36 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1697 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K20 | CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1701 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S8-1 | CCGGAATTCCTAATACGACTC-TGCGGACTGTATCGGTCGGTCGAAAATAGTGAAGTGC-TATTGAAACGCGGCCGCGG | 77 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1702 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S8-4 | CCGGAATTCCTAATACGACTC-ACTACGCACGGCGCGAGTAAATCGATCATGGTACTGTGGC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1703 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S8-7 | CCGGAATTCCTAATACGACTC-GGTTCCGGTAAGATTAGATCATAACGTATGGCTAGCGCCA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1704 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S9-3 | CCGGAATTCCTAATACGACTC-GAAAACGTACCACTGGGATGGGTTGTGGGAGAGGGCCAGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | G-quadruplex sequence motifs are found in the S9-3, S10-10 and S10-15 aptamer sequences, with G-scores of 40, 20 and 10 (2 motifs), and 13, respectively. | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1705 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-1 | CCGGAATTCCTAATACGACTC-TATGGAGTTTGTCCGTATGATTACGTGATATCGCGACGGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1706 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-2 | CCGGAATTCCTAATACGACTC-CAGCAAACGCAGTCCAACAGCCGACAAACGGTCTTGAGGC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1707 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-5 | CCGGAATTCCTAATACGACTC-TACAAAAAGTCGTGGTCCAGTTGCCATGTGTAAAACTGTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1708 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-6 | CCGGAATTCCTAATACGACTC-AACCAGACCACGCGAGAGGGCTCACAGTGAGACGTGAAGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1709 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-7 | CCGGAATTCCTAATACGACTC-TGGTGGGTAAAGACACCATACTGATAGTTACAAGGATGTT-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1710 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-8 | CCGGAATTCCTAATACGACTC-GCAACTTCAGTTCAGCAAGGTGCCGGCCACGCGACGGTCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1711 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-10 | CCGGAATTCCTAATACGACTC-ATCCAGCAGATGTGCGCGGGTTGGTGGGGGAACGGTGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | G-quadruplex sequence motifs are found in the S9-3, S10-10 and S10-15 aptamer sequences, with G-scores of 40, 20 and 10 (2 motifs), and 13, respectively. | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1712 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-15 | CCGGAATTCCTAATACGACTC-GTAGCACTATAGGCAGCACGAATATGGCCGTCGGAGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | G-quadruplex sequence motifs are found in the S9-3, S10-10 and S10-15 aptamer sequences, with G-scores of 40, 20 and 10 (2 motifs), and 13, respectively. | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1778 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | T1-280 | ACTGTCrGrCrGrCrArCrGrCrGrUrGrUrGrUrArGrUrArCrArCrArCrGrArUrCrGrCrGrCrGrCrArCrArArUrArU | 46 | N/A | ssRNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of T1-280 RNA was 113 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 2.2 ± 0.5 nM | Detection | In-silico Method | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide | N/A | N/A | N/A | N/A | N/A |
| ABdb_1779 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | T2-139040 | ACTGTCrArArUrUrUrGrArArUrArUrArUrUrArGrUrGrCrGrCrGrCrCrGrUrArGrUrGrUrGrUrArArArArArUrU | 46 | N/A | ssRNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of T2-139040 RNA was 17 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 1.0 ± 0.3 nM | Detection | In-silico Method | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide | N/A | N/A | N/A | N/A | N/A |
| ABdb_1780 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | T3-117558 | ACTGTCrArArUrUrUrGrArGrUrGrUrGrUrGrArUrCrArUrArUrArUrCrGrUrArGrCrGrCrGrCrUrArCrArArCrC | 46 | N/A | ssRNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of T3-117558 RNA was 11 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 0.7 ± 0.4 nM | Detection | In-silico Method | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide | N/A | N/A | N/A | N/A | N/A |
| ABdb_1781 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | A14 | ACTGTCCACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT | 54 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of A14 DNA was 485 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 4 ± 2 nM | Detection | N/A | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1811 | https://doi.org/10.3390/fishes8100477 | 2023 | A Novel Method for Sensitive Detection of Vibrio alginolyticus Based on Aptamer and Hybridization Chain Reaction in Aquaculture | Aptamer | GAGAGAGAATATAAGGGAAAAAAAATCAGTCGCTTCGCCGTCTCCTTCGGGGGCGCGGTGAGGGGCTGCACAAGAGGGAGGCACAAGAGGGAGACCCCAGAGGG | 104 | N/A | ssDNA | Vibrio Alginolyticus (ATCC 17749) | Whole cell | Developed a method using an HCR-based multivalent aptamer (multi-Apt) for the detection of Vibrio alginolyticus. | Obtained a linear range from 10 to 10(7) CFU/mL, and the limit of detection (LOD) is 3 CFU/mL. | N/A | N/A | N/A | Detection | N/A | SA-HRP or 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1832 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-19 | TCCCTACGGCGCTAAC-GACATGATGGTGCCAAACAACATTCGGAAAGCCTGACCGT-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | Limit of Detection (LOD): 4.6 CFU/mL and linear trend ranging from 10 to 10(8) CFU/mL. | 10 | Fluorescence Binding Assay | 14.19 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1833 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-3 | TCCCTACGGCGCTAAC-TGGCAAATAATGCAATTGAAGAAAGCCCCCCCCTGCCCGA-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 15.61 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1834 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-29 | TCCCTACGGCGCTAAC-TGTGAAACAAGGCAAGGGAACTGACGTCATAAGGATAGCA-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 17.38 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1835 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-37 | TCCCTACGGCGCTAAC-AAGATGAAAGACGACCGGACAGTACATATAGCGCTCTCGC-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 17.96 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1836 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-31 | TCCCTACGGCGCTAAC-ACCTGCAGTAGGGAATGCGAATGATGAGACGCCTGATTGG-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 68.83 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1837 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-24 | TCCCTACGGCGCTAAC-ACAGACAGAATGAGTGAACATAGGCCAATAACGCACGTCC-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 75.24 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1896 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S8 | CGTACGGTCGACGCTAGC-ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1897 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S10 | CGTACGGTCGACGCTAGC-ACCAGCCATAGTCACATCAAAACTAACTCACATTC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1898 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S12 | CGTACGGTCGACGCTAGC-CCCATACTCATCACCATTCACATCACTCACCTAGC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1899 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S1 | GGATCCGAGCTCCACGTG-GCTAGGTGAGTGATGTGAATGGTGATGAGTATGGG-GCTAGCGTCGACCGTACG | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S1, the Ru-modified oligonucleotide, bound S. pneumoniae R6 with slightly lower affinity than S9. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 125 ± 91 nM | Detection | SELEX and Mod-SELEX | T=dURu(bpy)TP1, 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1900 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S9 | ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S9 bound better to the bacterial target than the modified sequence S1. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 118 ± 1 nM | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1901 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S11 | ACCAGCCATAGTCACATCAAAACTAACTCACATTC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S11 exhibited a lower propensity at binding to the bacterial target. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 541 ± 1 nM | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1902 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S13 | CCCATACTCATCACCATTCACATCACTCACCTAGC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1928 | 40916637 | 2025 | Study of Bacteriostasis of Kaempferide on Foodborne Pathogenic Bacteria by Indirect Determination of Capillary Electrophoresis | AP1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed an aptamer-based capillary sieving electrophoresis (CE)-Laser-induced fluorescence (LIF) detection of three bacteria, Vibrio parahaemolyticus, Escherichia coli, and Staphylococcus aureus. | The measured limit of detection (LOD) for V. parahaemolyticus was 3.70 × 10(6) CFU/mL and a linear range of 0.80-124 × 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1929 | 40916637 | 2025 | Study of Bacteriostasis of Kaempferide on Foodborne Pathogenic Bacteria by Indirect Determination of Capillary Electrophoresis | AP2 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Developed an aptamer-based capillary sieving electrophoresis (CE)-Laser-induced fluorescence (LIF) detection of three bacteria, Vibrio parahaemolyticus, Escherichia coli, and Staphylococcus aureus. | The measured limit of detection (LOD) for E. coli was 1.28 × 10(7) CFU/mL and a linear range of 6.50 - 153 × 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | Extension chain for AP2 (T2) , 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1930 | 40916637 | 2025 | Study of Bacteriostasis of Kaempferide on Foodborne Pathogenic Bacteria by Indirect Determination of Capillary Electrophoresis | AP3 | TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 6538) | Whole cell | Developed an aptamer-based capillary sieving electrophoresis (CE)-Laser-induced fluorescence (LIF) detection of three bacteria, Vibrio parahaemolyticus, Escherichia coli, and Staphylococcus aureus. | The measured limit of detection (LOD) for S. aureus was 1.67 × 10(7) CFU/mL and a linear range of 3.00-150 × 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | Extension chain for AP3 (T3), 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1934 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 7.1 | ACACTAGATCAGTCACAG-GATTAAGGATCGTTGTTGGGTGGTTTCCGTAATTACTATC-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1935 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 15.1 | ACACTAGATCAGTCACAG-GGTTGCTCAGGAGAAGGGAACGTGGGTGGTGGCGCGGACG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1936 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 3.1 | ACACTAGATCAGTCACAG-ACGGGGAGAGGGTCATCTCTGGTTTCGGGGTGCTAATTCT-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1937 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 8.1 | ACACTAGATCAGTCACAG-CCCCGACCTGTACACGTACTACCCGATGACATTTGGTGTT-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1938 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 13.1 | ACACTAGATCAGTCACAG-TGGACGCGGCGGGCCGGATTAAGTTGAGGAGAGGGGGGTG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1939 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 16.1 | ACACTAGATCAGTCACAG-AGTATATATGGATTCCGCAACGTACGCAGGGGGTGTCGCC-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1940 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 14.1 | ACACTAGATCAGTCACAG-CAGAGAGGGGCGGCGAGGGACAAAGGAGGGTAGGTGTGCC-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1941 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 12.1 | ACACTAGATCAGTCACAG-ATCACAGCGGAGGTTTAACGTGTGGCGGGTGTGGGGACATG-GACTTGACTCAGACATCT | 77 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1942 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 11.1 | ACACTAGATCAGTCACAG-GAGCAACAGTCTCGCCTTCGTTACTGCGCGCGGGACGGGG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | CA 11.1 exhibited S. aureus binding in a linear range of 10(3) to 10(8) CFU/mL and a limit of detection (LOD) of 10(3) CFU/mL. | 11 | Bead-based Binding Assay | 263.8 ± 78 nM | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1943 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 17.1 | ACACTAGATCAGTCACAG-AAGTGGAATCAAGCATGGGTATTTTAAGCATCGTATCTCG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1944 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 5.1 | ACACTAGATCAGTCACAG-TGTTTCACGGGGGGGAGGGTAACGGAAGCTAATGGTCTCG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1951 | 10451913 | 1999 | In vitro selection of DNA aptamers to anthrax spores with electrochemiluminescence detection | Aptamer pool | N/A | N/A | N/A | ssDNA | Bacillus Anthracis (BA) | Anthrax spores | Develop an aptamer–magnetic bead-electrochemiluminescence (AM-ECL) sandwich assay for detecting anthrax spores. | Display broad dynamic range equivalent to 10– 6×10(6) anthrax spores. | 4 | ECL-based and Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1956 | 17344350 | 2007 | Development and characterization of monoclonal antibodies and aptamers against major antigens of Mycobacterium avium subsp. paratuberculosis | Aptamer 94 | N/A | N/A | 5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3' | ssDNA | Mycobacterium Avium subsp. paratuberculosis (ATCC 19698) | MAP0105c gene product | Identify aptamers that were screened against the MAP0105c gene product. | Bound specifically to the N-terminal half of MAP0105c, and nearly all mycobacteria tested. | 12 | N/A | N/A | Detection | Counter-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1958 | 20582587 | 2010 | Selection and characterization of DNA aptamers with binding selectivity to Campylobacter jejuni using whole-cell SELEX | ONS-23 | N/A | N/A | 5'-GTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Campylobacter Jejuni (A9a) | Whole cell (bind via proteinaceous nature for cell surface target) | Identify aptamers against C. jejuni and detect them in a mixed cell population. | ONS-23 showed high binding affinity (25–36%) for all other C. jejuni strains screened (inclusivity) and low apparent binding affinity (1–5%) with non-C. jejuni strains (exclusivity). | 10 | Flow Cytometry | 292.8 ± 53.1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | WO Patent WO/2011/097420 |
| ABdb_1959 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.11 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | CSIR 2.11 achieved 100% sensitivity and 68.75% specificity in detecting antigen in sputum samples. | 6 | Surface Plasmon Resonance (SPR) | 8 ± 1.07 nM | Detection | SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1960 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.19 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | N/A | 6 | Surface Plasmon Resonance (SPR) | 1.6 ± 0.5 nM | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1961 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.2 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | N/A | 6 | Surface Plasmon Resonance (SPR) | 21.5 ± 4.3 nM | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1962 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.15 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | N/A | 6 | Surface Plasmon Resonance (SPR) | 12 ± 1.6 nM | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1963 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.21 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | N/A | 6 | Surface Plasmon Resonance (SPR) | 10.2 ± 3.4 nM | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1970 | 23381690 | 2013 | Selection of aptamers against inactive Vibrio alginolyticus and application in a qualitative detection assay | Pool of enriched aptamers | N/A | N/A | 5'-TCAGTCGCTTCGCCGTCTCCTTC-N35-GCACAAGAGGGAGACCCCAGAGGG-3' | ssDNA | Vibrio Alginolyticus | Whole cell (Inactivated) | Identify aptamers against and qualitatively detect inactive Vibrio alginolyticus using PCR. | V. alginolyticus could be detected at 100 cells/ml. | 15 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 27.5 ± 9.2 nM | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1971 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4936–4 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 3.1 nM | Detection | SELEX | 5-tyrosylaminocarbonyl-dU (TyrdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1972 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4939–280 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 1.6 nM | Detection | SELEX | 5-naphthylmethylaminocarbonyl-dU (NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1973 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4943–51 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | Developed toxin assays show a limit of detection of 1 pmol/L (300 pg/mL) and a 3-log dynamic range. | 8 | Equilibrium Binding Assay | 1.3 nM | Detection | SELEX | 5-tyrosylaminocarbonyl-dU (TyrdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1974 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5564–89 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 9.8 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1975 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5570–54 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 6.6 nM | Detection | SELEX | 5-phenylethyl-1-aminocarbonyl (PEdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1976 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4937–55 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.76 nM | Detection | SELEX | 5-tyrosylaminocarbonyl-dU (TyrdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1977 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4938–17 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.45 nM | Detection | SELEX | 5-benzylaminocarbonyl-dU (BndU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1978 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4940–23 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | Developed toxin assays show a limit of detection of 1 pmol/L (300 pg/mL) and a 3-log dynamic range. | 8 | Equilibrium Binding Assay | 0.07 nM | Detection | SELEX | 5-naphthylmethylaminocarbonyl-dU (NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1979 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4944–30 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.08 nM | Detection | SELEX | 5-tryptaminocarbonyl-dU (TrpdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1980 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5566–74 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.04 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1981 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5573–4 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.07 nM | Detection | SELEX | 5-phenylethyl-1-aminocarbonyl (PEdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1982 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4758–6 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, A chain (CdtA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.22 nM | Detection | SELEX | 5-tryptaminocarbonyl-dU (TrpdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1983 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5574–49 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, A chain (CdtA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 1.1 nM | Detection | SELEX | 5-phenylethyl-1-aminocarbonyl (PEdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1984 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5579–11 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, A chain (CdtA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.05 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1985 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5579–12 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, A chain (CdtA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | Developed toxin assays show a limit of detection of 1 pmol/L (300 pg/mL) and a 3-log dynamic range. | 8 | Equilibrium Binding Assay | 0.69 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1986 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5556–51 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, B chain (CdtB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 6.9 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1987 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5556–67 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, B chain (CdtB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 4.4 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1988 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4520–8 | PCGGCPPCGGGPACCPAPPAPCGGPPPAGCCCAGPCAGAA | 40 | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Staphylococcus aureus Protein A (SpA) | Developed slow off-rate modified aptamer (SOMAmer) reagents against S. aureus cell surface-associated proteins, used to capture and detect S. aureus. | Efficient capture of Staph. aureus over a wide range of cell densities from 5 × 10(2) CFU/ml to 5 × 10(9) CFU/ml. | 8 | Radiolabel Filter Binding Assay | 0·22 nM | Detection | SELEX | P=NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1989 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4503–73 | AZCZGGZZCAAAGZGGCGAZZGGGCAZCZGGZZZZZAAGZ | 40 | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor A (ClfA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | Efficient capture of Staph. aureus over a wide range of cell densities from 5 × 10(2) CFU/ml to 5 × 10(9) CFU/ml. | 8 | Radiolabel Filter Binding Assay | 0·79 nM | Detection | SELEX | Z=BndU (5-benzylaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1990 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4531–56 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Staphylococcus aureus Protein A (SpA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | Able to bind whole cells of all Staph. aureus strains tested, with a detection limit of approx. 10(4) cells per well (10(5)-10(6) cells/ml). | 8 | Radiolabel Filter Binding Assay | 0·03 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1991 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4522–5 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor A (ClfA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·35 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1992 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4504–27 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor B (ClfB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 1·35 nM | Detection | SELEX | BndU (5-benzylaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1993 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4511–67 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor B (ClfB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 3·90 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1994 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4523–79 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor B (ClfB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·47 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1995 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4726–44 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding Protein A (FnbA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 4·38 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1996 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4745–51 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding Protein A (FnbA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·63 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1997 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4506–13 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding protein B (FnbB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 4·73 nM | Detection | SELEX | BndU (5-benzylaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1998 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4516–29 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding protein B (FnbB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·63 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1999 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4527–83 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding protein B (FnbB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·84 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2000 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4727–62 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein A (IsdA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·73 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2001 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4746–3 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein A (IsdA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·16 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2002 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4728–7 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein B (IsdB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·14 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2003 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4747–90 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein B (IsdB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 1·98 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2004 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4507–52 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein C (IsdC) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·15 nM | Detection | SELEX | BndU (5-benzylaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2005 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4517–71 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein C (IsdC) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·08 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2006 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4528–22 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein C (IsdC) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·07 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2007 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4731–69 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein H (IsdH) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 1·30 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2008 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4730–3 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | SasD | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 2·17 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2009 | https://doi.org/10.1016/j.lwt.2013.12.012 | 2014 | Development and evaluation of aptamer magnetic capture assay in conjunction with real-time PCR for detection of Campylobacter jejuni | Aptamer 229 | N/A | N/A | N/A | ssDNA | Campylobacter Jejuni (A9a) | Whole cell | Develop an aptamer-based magnetic capture-qPCR (AMC-qPCR) assay for the detection of Campylobacter jejuni. | Capture efficiency was 10–13% at the detection limit of 1.1 log10/300 μl C. jejuni cells and a range of 1.0–2.0 log10 CFU per sample (0.3-10 ml). | N/A | N/A | N/A | Detection | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | WO Patent WO/2011/097420 |
| ABdb_2010 | 24968239 | 2014 | CFP10 and ESAT6 aptamers as effective Mycobacterial antigen diagnostic reagents | CE24 | N/A | N/A | 5'-GCGGAATTCTAATACGACTCACTATAGGGA ACAGTCCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CE (Culture filtrate protein (CFP10) and Early secreted antigenic target (ESAT6)) proteins | Identify aptamers against CE proteins and develop an aptamer-based ELONA assay for detection in serum samples. | Sensitivity and specificity using CE24 aptamer-based ELONA) were 100% and 94.1%. | 15 | Enzyme-Linked Immunosorbent Assay (ELISA) | 3.75 × 10(−7) M | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2011 | 24968239 | 2014 | CFP10 and ESAT6 aptamers as effective Mycobacterial antigen diagnostic reagents | CE15 | N/A | N/A | 5'-GCGGAATTCTAATACGACTCACTATAGGGA ACAGTCCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CE (Culture filtrate protein (CFP10) and Early secreted antigenic target (ESAT6)) proteins | Identify aptamers against CE proteins and develop an aptamer-based ELONA assay for detection in serum samples. | Sensitivity and specificity using CE15 aptamer-based ELONA) were 89.6% and 94.1%. | 15 | Enzyme-Linked Immunosorbent Assay (ELISA) | 1.6 × 10(−7) M | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2017 | 27151293 | 2016 | Identification of ssDNA aptamers specific to clinical isolates of Streptococcus mutans strains with different cariogenicity | H19 | N/A | N/A | 5'-GCAATGGTACGGTACTTCC-45N-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Streptococcus Mutans | Whole cell | Identify a high-affinity aptamer against cariogenic S. mutans strains. | Aptamer H19 showed strong binding, as indicated by higher fluorescence intensity, with Strains 12 and 17 compared with other strains. | 9 | Flow Cytometry | 69.45 ± 38.53 nM | Detection | Subtractive SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2018 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T9 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | Specificity and sensitivity were 95.31% and 83.00% (for 100 aPTB serum samples), 98.70% and 92.71% (for 96 aPTB sputum samples), and 94.44% and 88.71% (for 62 EPTB serum samples), respectively. | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 668 ± 159 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2019 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T25 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 685 ± 131 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2020 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T14 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 815 ± 144 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2021 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T15 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 736 ± 207 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2022 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T6 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 998 ± 207 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2109 | https://doi.org/10.1007/s00604-017-2453-3 | 2017 | Orientation selection of broad-spectrum aptamers against lipopolysaccharides based on capture-SELEX by using magnetic nanoparticles | EA10 | N/A | N/A | 5'-ATAGGAGTCACGACGACCAG-40N-TATGTGCGTCTACCTCTTGA-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50671) | Lipopolysaccharide (LPS) lipid A domain | Identify aptamers that bind to the LPS target. | N/A | 15 | Fluorescence Binding Assay | 28 ± 4 nM | Detection | Orientation selection based on Capture-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2110 | https://doi.org/10.1007/s00604-017-2453-3 | 2017 | Orientation selection of broad-spectrum aptamers against lipopolysaccharides based on capture-SELEX by using magnetic nanoparticles | EA7 | N/A | N/A | 5'-ATAGGAGTCACGACGACCAG-40N-TATGTGCGTCTACCTCTTGA-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50671) | Lipopolysaccharide (LPS) lipid A domain | Identify aptamers that bind to the LPS target. | EA7 binds to the lipid A region of LPS and exhibits a detection limit of 3 ng/mL and a linear range of 5–250 ng/mL. | 15 | Fluorescence Binding Assay | 102 ± 17 nM | Detection | Orientation selection based on Capture-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2111 | https://doi.org/10.1007/s00604-017-2453-3 | 2017 | Orientation selection of broad-spectrum aptamers against lipopolysaccharides based on capture-SELEX by using magnetic nanoparticles | EA5 | N/A | N/A | 5'-ATAGGAGTCACGACGACCAG-40N-TATGTGCGTCTACCTCTTGA-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50671) | Lipopolysaccharide (LPS) lipid A domain | Identify aptamers that bind to the LPS target. | N/A | 15 | Fluorescence Binding Assay | 149 ± 30 nM | Detection | Orientation selection based on Capture-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2113 | https://doi.org/10.1016/j.snb.2017.02.098 | 2017 | Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators | PA05 | N/A | N/A | N/A | ssDNA | Streptococcus Pneumoniae | Surface-specific Protein PavA | Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis. | N/A | 8 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU)) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2114 | https://doi.org/10.1016/j.snb.2017.02.098 | 2017 | Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators | PA08 | N/A | N/A | N/A | ssDNA | Streptococcus Pneumoniae | Surface-specific Protein PavA | Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis. | The polyclonal population PA08 showed a frequency shift four times greater and a faster reaction rate than FH05 when measured on the gravimetric sensor. | 8 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU)) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2115 | https://doi.org/10.1016/j.snb.2017.02.098 | 2017 | Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators | FH05 | N/A | N/A | N/A | ssDNA | Neisseria Meningitidis | Surface-specific Protein FHbp | Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis. | The polyclonal population PA08 showed a frequency shift four times greater and a faster reaction rate than FH05 when measured on the gravimetric sensor. | 8 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU)) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2116 | https://doi.org/10.1016/j.snb.2017.02.098 | 2017 | Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators | FH08 | N/A | N/A | N/A | ssDNA | Neisseria Meningitidis | Surface-specific Protein FHbp | Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis. | N/A | 8 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU)) | N/A | N/A | N/A | N/A | N/A |