MycoBiomDB

DB ID	Host Group	Host Name	Disease	Fungus Involved	Biomarker	Biomolecule	Biomarker Type	Site of Infection	Age Group	Geographical Location	Genus	Sample Category	Sample Type	Technique	Technique Type	PMID
MyCo_5518	Human	Human	Mucormycosis	Cunninghamella bertholletiae	146-bp portion of the D1/D2 region	Protein	Diagnostic	Unspecified	23	Japan	Cunninghamella	Extracted DNA	Biopsy	Molecular Methods	PCR	32461900
MyCo_5519	Animal	Rabbit	Mucormycosis	Cunninghamella bertholletiae	28S rRNA gene	Gene	Diagnostic	Unspecified	None	Greece	Cunninghamella	Serum	Body fluid	Molecular Methods	PCR	22686246
MyCo_5520	Animal	Rabbit	Mucormycosis	Cunninghamella bertholletiae	28S rRNA gene	Gene	Diagnostic	Unspecified	None	USA	Cunninghamella	Bronchoalveolar lavage fluid (BALF)	Body fluid	Molecular Methods	PCR	18845827
MyCo_5521	Animal	Rabbit	Mucormycosis	Cunninghamella bertholletiae	28S rRNA gene	Gene	Diagnostic	Unspecified	None	USA	Cunninghamella	Extracted Lungs tissue	Biopsy	Molecular Methods	PCR	18845827
MyCo_5670	Human	Human	Mucormycosis	Cunninghamella bertholletiae	(FAM)TCGGTCGGCGTGGTTCTCTGCCCA (TAMRA)	Gene	Diagnostic	Unspecified	61	France	Cunninghamella	Serum	Body fluid	Molecular Methods	PCR	29712993