MucormyDB: A webportal for managing resources on Mucormycosis

  • Home
  • Genomics/Proteomics
    • Whole Genome
    • Protein Sequences
    • Nucleotide Sequences
  • Immunotherapy
    • siRNA based
    • Peptide based
    • Vaccine adjuvants
  • Drugs
    • Available Drugs
    • Potential Drug Molecules
    • 3-D Structure
  • Additional Info
    • Diagnosis
    • Literature
    • Video Lectures
    • Data Submission
    • FAQs
  • About
    • Team
    • Contact Us

  • Welcome to Vaccine adjuvants prediction page

    ----------------------------------------------------------------------------------------------------------------------------------------------------

    These are predicted oligodeoxynucleoides vaccine adjuvants SAPs protein of Rhizopus oryzae.

    ------------------------------------------------------------------------------------------------------------------------------------------------------

         Click here to download
    SequenceStart PositionClassSVM ScoreLengthMol. Wt.TmGC content(%)
    AGATTCTTTACAAGCTTCTT387Immunomodulatory 1.274 20 6057.03 43.58 30
    AAACTAATCGAATTTTTATG124Immunomodulatory 1.232 20 6114.1 39.48 20
    AACTAATCGAATTTTTATGT125Immunomodulatory 1.214 20 6105.09 39.48 20
    ACTAATCGAATTTTTATGTA126Immunomodulatory 1.176 20 6105.09 39.48 20
    ACAAGCTTCTTATTTCTGTA396Immunomodulatory 1.125 20 6057.03 43.58 30
    ACCATTTTGGTCATATCTTG306Immunomodulatory 1.104 20 6073.03 45.63 35
    AAATGATGAACTTTATACAA452Immunomodulatory 1.051 20 6132.12 39.48 20
    ACCTAATGTACTTTGTCGTA1992Immunomodulatory 1.044 20 6082.04 45.63 35
    ATGATGAACTTTATACAATC454Immunomodulatory 1.043 20 6099.08 41.53 25
    ACTCGAGATTTTTAGCACAA1745Immunomodulatory 1.036 20 6100.06 45.63 35

IIIT Delhi

Raghava's group