Welcome to Vaccine adjuvants prediction page
----------------------------------------------------------------------------------------------------------------------------------------------------
These are predicted oligodeoxynucleoides vaccine adjuvants SAPs protein of Rhizopus oryzae.
------------------------------------------------------------------------------------------------------------------------------------------------------
Click here to download
| Sequence | Start Position | Class | SVM Score | Length | Mol. Wt. | Tm | GC content(%) |
| AGATTCTTTACAAGCTTCTT | 387 | Immunomodulatory | 1.274 | 20 | 6057.03 | 43.58 | 30 |
| AAACTAATCGAATTTTTATG | 124 | Immunomodulatory | 1.232 | 20 | 6114.1 | 39.48 | 20 |
| AACTAATCGAATTTTTATGT | 125 | Immunomodulatory | 1.214 | 20 | 6105.09 | 39.48 | 20 |
| ACTAATCGAATTTTTATGTA | 126 | Immunomodulatory | 1.176 | 20 | 6105.09 | 39.48 | 20 |
| ACAAGCTTCTTATTTCTGTA | 396 | Immunomodulatory | 1.125 | 20 | 6057.03 | 43.58 | 30 |
| ACCATTTTGGTCATATCTTG | 306 | Immunomodulatory | 1.104 | 20 | 6073.03 | 45.63 | 35 |
| AAATGATGAACTTTATACAA | 452 | Immunomodulatory | 1.051 | 20 | 6132.12 | 39.48 | 20 |
| ACCTAATGTACTTTGTCGTA | 1992 | Immunomodulatory | 1.044 | 20 | 6082.04 | 45.63 | 35 |
| ATGATGAACTTTATACAATC | 454 | Immunomodulatory | 1.043 | 20 | 6099.08 | 41.53 | 25 |
| ACTCGAGATTTTTAGCACAA | 1745 | Immunomodulatory | 1.036 | 20 | 6100.06 | 45.63 | 35 |