Welcome to Vaccine adjuvants prediction page
----------------------------------------------------------------------------------------------------------------------------------------------------
These are predicted oligodeoxynucleoides vaccine adjuvants related to Gwt1 protein of Rhizopus oryzae.
------------------------------------------------------------------------------------------------------------------------------------------------------
Click here to download
| Sequence | Start Position | Class | SVM Score | Length | Mol. Wt. | Tm | GC content(%) |
| TACTTGACAGTCTATCGTGC | 118 | Immunomodulatory | 1.436 | 20 | 6083.02 | 49.73 | 45 |
| CTTGACAGTCTATCGTGCTG | 120 | Immunomodulatory | 1.401 | 20 | 6099.02 | 51.78 | 50 |
| TAGTCTCGTCGAGATCTTAT | 275 | Immunomodulatory | 1.379 | 20 | 6098.04 | 47.68 | 40 |
| TTACTTGACAGTCTATCGTG | 117 | Immunomodulatory | 1.377 | 20 | 6098.04 | 47.68 | 40 |
| GTAGTCTCGTCGAGATCTTA | 274 | Immunomodulatory | 1.306 | 20 | 6123.05 | 49.73 | 45 |
| ACTTGACAGTCTATCGTGCT | 119 | Immunomodulatory | 1.303 | 20 | 6083.02 | 49.73 | 45 |
| TCGTCGAGATCTTATATGAA | 280 | Immunomodulatory | 1.27 | 20 | 6131.08 | 45.63 | 35 |
| CGTAGTCTCGTCGAGATCTT | 273 | Immunomodulatory | 1.256 | 20 | 6099.02 | 51.78 | 50 |
| CAGTCTATCGTGCTGGACTC | 125 | Immunomodulatory | 1.255 | 20 | 6084 | 53.83 | 55 |
| AGTCTCGTCGAGATCTTATA | 276 | Immunomodulatory | 1.249 | 20 | 6107.05 | 47.68 | 40 |