MucormyDB: A webportal for managing resources on Mucormycosis

  • Home
  • Genomics/Proteomics
    • Whole Genome
    • Protein Sequences
    • Nucleotide Sequences
  • Immunotherapy
    • siRNA based
    • Peptide based
    • Vaccine adjuvants
  • Drugs
    • Available Drugs
    • Potential Drug Molecules
    • 3-D Structure
  • Additional Info
    • Diagnosis
    • Literature
    • Video Lectures
    • Data Submission
    • FAQs
  • About
    • Team
    • Contact Us

  • Welcome to Vaccine adjuvants prediction page

    ----------------------------------------------------------------------------------------------------------------------------------------------------

    These are predicted oligodeoxynucleoides vaccine adjuvants related to Gwt1 protein of Rhizopus oryzae.

    ------------------------------------------------------------------------------------------------------------------------------------------------------

         Click here to download
    SequenceStart PositionClassSVM ScoreLengthMol. Wt.TmGC content(%)
    TACTTGACAGTCTATCGTGC118Immunomodulatory 1.436 20 6083.02 49.73 45
    CTTGACAGTCTATCGTGCTG120Immunomodulatory 1.401 20 6099.02 51.78 50
    TAGTCTCGTCGAGATCTTAT275Immunomodulatory 1.379 20 6098.04 47.68 40
    TTACTTGACAGTCTATCGTG117Immunomodulatory 1.377 20 6098.04 47.68 40
    GTAGTCTCGTCGAGATCTTA274Immunomodulatory 1.306 20 6123.05 49.73 45
    ACTTGACAGTCTATCGTGCT119Immunomodulatory 1.303 20 6083.02 49.73 45
    TCGTCGAGATCTTATATGAA280Immunomodulatory 1.27 20 6131.08 45.63 35
    CGTAGTCTCGTCGAGATCTT273Immunomodulatory 1.256 20 6099.02 51.78 50
    CAGTCTATCGTGCTGGACTC125Immunomodulatory 1.255 20 6084 53.83 55
    AGTCTCGTCGAGATCTTATA276Immunomodulatory 1.249 20 6107.05 47.68 40

IIIT Delhi

Raghava's group