MucormyDB: A webportal for managing resources on Mucormycosis

  • Home
  • Genomics/Proteomics
    • Whole Genome
    • Protein Sequences
    • Nucleotide Sequences
  • Immunotherapy
    • siRNA based
    • Peptide based
    • Vaccine adjuvants
  • Drugs
    • Available Drugs
    • Potential Drug Molecules
    • 3-D Structure
  • Additional Info
    • Diagnosis
    • Literature
    • Video Lectures
    • Data Submission
    • FAQs
  • About
    • Team
    • Contact Us

  • Welcome to Vaccine adjuvants prediction page

    ----------------------------------------------------------------------------------------------------------------------------------------------------

    These are predicted oligodeoxynucleoides vaccine adjuvants related to FTR1 protein of Rhizopus oryzae.

    ------------------------------------------------------------------------------------------------------------------------------------------------------

         Click here to download
    SequenceStart PositionClassSVM ScoreLengthMol. Wt.TmGC content(%)
    TACCTTGAACAAAATGCTTG676Immunomodulatory 1.393 20 6100.06 45.63 35
    ACCTTGAACAAAATGCTTGG677Immunomodulatory 1.304 20 6125.07 47.68 40
    CGTTGGTTCTTTGTGTTCTC604Immunomodulatory 1.295 20 6087.01 49.73 45
    GTCGTTCTTTACCTTGTCGC628Immunomodulatory 1.209 20 6040.97 51.78 50
    CTTGATTCAACTTCGTTGGT591Immunomodulatory 1.19 20 6089.03 47.68 40
    CAACTTCGTTGGTTCTTTGT598Immunomodulatory 1.181 20 6080.02 47.68 40
    CCTTGATTCAACTTCGTTGG590Immunomodulatory 1.176 20 6074.01 49.73 45
    GATTCAACTTCGTTGGTTCT594Immunomodulatory 1.148 20 6089.03 47.68 40
    CCTTTTATCACCGTTCTCAG439Immunomodulatory 1.118 20 5993.95 49.73 45
    CCTTGAACAAAATGCTTGGA678Immunomodulatory 1.101 20 6125.07 47.68 40

IIIT Delhi

Raghava's group