Welcome to Vaccine adjuvants prediction page
----------------------------------------------------------------------------------------------------------------------------------------------------
These are predicted oligodeoxynucleoides vaccine adjuvants related to DHD protein of Rhizopus oryzae.
------------------------------------------------------------------------------------------------------------------------------------------------------
Click here to download
| Sequence | Start Position | Class | SVM Score | Length | Mol. Wt. | Tm | GC content(%) |
| AGTTTCTATCGGTCGTCGTC | 921 | Immunomodulatory | 2.024 | 20 | 6090.01 | 51.78 | 50 |
| CTATCGGTCGTCGTCCTTAC | 926 | Immunomodulatory | 1.512 | 20 | 6034.96 | 53.83 | 55 |
| AATTTTATCGCTTCTATAGC | 92 | Immunomodulatory | 1.42 | 20 | 6057.03 | 43.58 | 30 |
| ATTTTATCGCTTCTATAGCA | 93 | Immunomodulatory | 1.359 | 20 | 6057.03 | 43.58 | 30 |
| AGGTCGACGGTGATGTCGTC | 839 | Immunomodulatory | 1.302 | 20 | 6189.07 | 55.88 | 60 |
| ATACAGATCGTATTTTGGGT | 1328 | Immunomodulatory | 1.274 | 20 | 6162.1 | 45.63 | 35 |
| ATCGGTCGTCGTCCTTACAC | 928 | Immunomodulatory | 1.271 | 20 | 6043.97 | 53.83 | 55 |
| CAATTTTATCGCTTCTATAG | 91 | Immunomodulatory | 1.27 | 20 | 6057.03 | 43.58 | 30 |
| CGTTTTAGTTTCTATCGGTC | 915 | Immunomodulatory | 1.229 | 20 | 6080.02 | 47.68 | 40 |
| ATGCTGATACAGATCGTATT | 1322 | Immunomodulatory | 1.164 | 20 | 6131.08 | 45.63 | 35 |