MucormyDB: A webportal for managing resources on Mucormycosis

  • Home
  • Genomics/Proteomics
    • Whole Genome
    • Protein Sequences
    • Nucleotide Sequences
  • Immunotherapy
    • siRNA based
    • Peptide based
    • Vaccine adjuvants
  • Drugs
    • Available Drugs
    • Potential Drug Molecules
    • 3-D Structure
  • Additional Info
    • Diagnosis
    • Literature
    • Video Lectures
    • Data Submission
    • FAQs
  • About
    • Team
    • Contact Us

  • Welcome to Vaccine adjuvants prediction page

    ----------------------------------------------------------------------------------------------------------------------------------------------------

    These are predicted oligodeoxynucleoides vaccine adjuvants related to DHD protein of Rhizopus oryzae.

    ------------------------------------------------------------------------------------------------------------------------------------------------------

         Click here to download
    SequenceStart PositionClassSVM ScoreLengthMol. Wt.TmGC content(%)
    AGTTTCTATCGGTCGTCGTC921Immunomodulatory 2.024 20 6090.01 51.78 50
    CTATCGGTCGTCGTCCTTAC926Immunomodulatory 1.512 20 6034.96 53.83 55
    AATTTTATCGCTTCTATAGC92Immunomodulatory 1.42 20 6057.03 43.58 30
    ATTTTATCGCTTCTATAGCA93Immunomodulatory 1.359 20 6057.03 43.58 30
    AGGTCGACGGTGATGTCGTC839Immunomodulatory 1.302 20 6189.07 55.88 60
    ATACAGATCGTATTTTGGGT1328Immunomodulatory 1.274 20 6162.1 45.63 35
    ATCGGTCGTCGTCCTTACAC928Immunomodulatory 1.271 20 6043.97 53.83 55
    CAATTTTATCGCTTCTATAG91Immunomodulatory 1.27 20 6057.03 43.58 30
    CGTTTTAGTTTCTATCGGTC915Immunomodulatory 1.229 20 6080.02 47.68 40
    ATGCTGATACAGATCGTATT1322Immunomodulatory 1.164 20 6131.08 45.63 35

IIIT Delhi

Raghava's group