MucormyDB: A webportal for managing resources on Mucormycosis

  • Home
  • Genomics/Proteomics
    • Whole Genome
    • Protein Sequences
    • Nucleotide Sequences
  • Immunotherapy
    • siRNA based
    • Peptide based
    • Vaccine adjuvants
  • Drugs
    • Available Drugs
    • Potential Drug Molecules
    • 3-D Structure
  • Additional Info
    • Diagnosis
    • Literature
    • Video Lectures
    • Data Submission
    • FAQs
  • About
    • Team
    • Contact Us

  • Welcome to Vaccine adjuvants prediction page

    ----------------------------------------------------------------------------------------------------------------------------------------------------

    These are predicted oligodeoxynucleoides vaccine adjuvants related to CYP51 protein of Rhizopus oryzae.

    ------------------------------------------------------------------------------------------------------------------------------------------------------

         Click here to download
    SequenceStart PositionClassSVM ScoreLengthMol. Wt.TmGC content(%)
    ATGATGCGTCGTGTCGTCGC1189Immunomodulatory 1.631 20 6140.03 55.88 60
    CATGATGCGTCGTGTCGTCG1188Immunomodulatory 1.575 20 6140.03 55.88 60
    CTCTAGTTCCATCATGGATA187Immunomodulatory 1.244 20 6067.02 47.68 40
    CGTACCGTCGTCGGGATGAA797Immunomodulatory 1.234 20 6158.05 55.88 60
    CGTCGTGTCGTCGCCCCCAA1195Immunomodulatory 1.209 20 6029.93 59.98 70
    AGTTCCATCATGGATACCTT191Immunomodulatory 1.192 20 6067.02 47.68 40
    CCTCTAGTTCCATCATGGAT186Immunomodulatory 1.131 20 6042.99 49.73 45
    ACCTCTAGTTCCATCATGGA185Immunomodulatory 1.115 20 6052 49.73 45
    CTAGTTCCATCATGGATACC189Immunomodulatory 1.111 20 6052 49.73 45
    CTCGTACCGTCGTCGGGATG795Immunomodulatory 1.105 20 6125.01 57.93 65

IIIT Delhi

Raghava's group