i
Welcome to Vaccine adjuvants prediction page
----------------------------------------------------------------------------------------------------------------------------------------------------
These are predicted oligodeoxynucleoides vaccine adjuvants related to CotH3 protein of Rhizopus oryzae.
------------------------------------------------------------------------------------------------------------------------------------------------------
Click here to download
| Sequence | Start Position | Class | SVM Score | Length | Mol. Wt. | Tm | GC content(%) |
| AATATTTCTATCGTTTCCCA | 1579 | Immunomodulatory | 1.541 | 20 | 6017 | 43.58 | 30 |
| AGTTTTGATCGTTCTCTTGA | 223 | Immunomodulatory | 1.458 | 20 | 6104.05 | 45.63 | 35 |
| AATTTAATATTTCTATCGTT | 1574 | Immunomodulatory | 1.454 | 20 | 6071.07 | 37.43 | 15 |
| AAAGTTTTGATCGTTCTCTT | 221 | Immunomodulatory | 1.423 | 20 | 6088.05 | 43.58 | 30 |
| AGAAAGTTTTGATCGTTCTC | 219 | Immunomodulatory | 1.422 | 20 | 6122.07 | 45.63 | 35 |
| ATATTTCTATCGTTTCCCAA | 1580 | Immunomodulatory | 1.389 | 20 | 6017 | 43.58 | 30 |
| ATTTAATATTTCTATCGTTT | 1575 | Immunomodulatory | 1.335 | 20 | 6062.06 | 37.43 | 15 |
| AAGTTTTGATCGTTCTCTTG | 222 | Immunomodulatory | 1.292 | 20 | 6104.05 | 45.63 | 35 |
| ATTTCTATCGTTTCCCAACC | 1582 | Immunomodulatory | 1.21 | 20 | 5977.95 | 47.68 | 40 |
| ATATCAATGCTAAATTTTAT | 785 | Immunomodulatory | 1.209 | 20 | 6089.09 | 37.43 | 15 |