Welcome to Vaccine adjuvants prediction page
----------------------------------------------------------------------------------------------------------------------------------------------------
These are predicted oligodeoxynucleoides vaccine adjuvants related to Cda protein of Rhizopus oryzae.
------------------------------------------------------------------------------------------------------------------------------------------------------
Click here to download
| Sequence | Start Position | Class | SVM Score | Length | Mol. Wt. | Tm | GC content(%) |
| ACAAGAACGTTGTTGATGTT | 1055 | Immunomodulatory | 1.728 | 20 | 6171.11 | 45.63 | 35 |
| ACATTGGTTCTAACGTTGTT | 599 | Immunomodulatory | 1.598 | 20 | 6113.06 | 45.63 | 35 |
| CTACAAGAACGTTGTTGATG | 1053 | Immunomodulatory | 1.573 | 20 | 6156.09 | 47.68 | 40 |
| CCTACAAGAACGTTGTTGAT | 1052 | Immunomodulatory | 1.524 | 20 | 6116.06 | 47.68 | 40 |
| CAAGAACGTTGTTGATGTTG | 1056 | Immunomodulatory | 1.482 | 20 | 6187.11 | 47.68 | 40 |
| ATTGGTTCTAACGTTGTTAA | 601 | Immunomodulatory | 1.458 | 20 | 6137.09 | 43.58 | 30 |
| AAGAACGTTGTTGATGTTGC | 1057 | Immunomodulatory | 1.404 | 20 | 6187.11 | 47.68 | 40 |
| AGAACGTTGTTGATGTTGCC | 1058 | Immunomodulatory | 1.367 | 20 | 6163.08 | 49.73 | 45 |
| CATTGGTTCTAACGTTGTTA | 600 | Immunomodulatory | 1.338 | 20 | 6113.06 | 45.63 | 35 |
| CTAACGTTGTTAACTGGCCC | 608 | Immunomodulatory | 1.31 | 20 | 6068 | 51.78 | 50 |