MucormyDB: A webportal for managing resources on Mucormycosis

  • Home
  • Genomics/Proteomics
    • Whole Genome
    • Protein Sequences
    • Nucleotide Sequences
  • Immunotherapy
    • siRNA based
    • Peptide based
    • Vaccine adjuvants
  • Drugs
    • Available Drugs
    • Potential Drug Molecules
    • 3-D Structure
  • Additional Info
    • Diagnosis
    • Literature
    • Video Lectures
    • Data Submission
    • FAQs
  • About
    • Team
    • Contact Us

  • i

    Welcome to Vaccine adjuvants prediction page

    ----------------------------------------------------------------------------------------------------------------------------------------------------

    These are predicted oligodeoxynucleoides vaccine adjuvants related to CaN protein of Rhizopus oryzae.

    ------------------------------------------------------------------------------------------------------------------------------------------------------

         Click here to download
    SequenceStart PositionClassSVM ScoreLengthMol. Wt.TmGC content(%)
    CTTGAAAGATAATCAACTTC345Immunomodulatory 0.805 20 6084.06 43.58 30
    AACTTGAAAGATAATCAACT343Immunomodulatory 0.731 20 6117.1 41.53 25
    ACTTGAAAGATAATCAACTT344Immunomodulatory 0.731 20 6108.09 41.53 25
    ATGATTGCCATTTTTGATGA148Immunomodulatory 0.689 20 6137.09 43.58 30
    GGTTAATTCCTCTAATTTTT3Immunomodulatory 0.662 20 6063.04 41.53 25
    CCGTATGATTGCCATTTTTG144Immunomodulatory 0.63 20 6089.03 47.68 40
    ATAACTTGAAAGATAATCAA341Immunomodulatory 0.609 20 6141.13 39.48 20
    TGTTAAAAATGATGGTTGGA320Immunomodulatory 0.603 20 6235.17 43.58 30
    TATGATTGCCATTTTTGATG147Immunomodulatory 0.601 20 6128.08 43.58 30
    TAACTTGAAAGATAATCAAC342Immunomodulatory 0.595 20 6117.1 41.53 25

IIIT Delhi

Raghava's group