i
Welcome to Vaccine adjuvants prediction page
----------------------------------------------------------------------------------------------------------------------------------------------------
These are predicted oligodeoxynucleoides vaccine adjuvants related to CaN protein of Rhizopus oryzae.
------------------------------------------------------------------------------------------------------------------------------------------------------
Click here to download
| Sequence | Start Position | Class | SVM Score | Length | Mol. Wt. | Tm | GC content(%) |
| CTTGAAAGATAATCAACTTC | 345 | Immunomodulatory | 0.805 | 20 | 6084.06 | 43.58 | 30 |
| AACTTGAAAGATAATCAACT | 343 | Immunomodulatory | 0.731 | 20 | 6117.1 | 41.53 | 25 |
| ACTTGAAAGATAATCAACTT | 344 | Immunomodulatory | 0.731 | 20 | 6108.09 | 41.53 | 25 |
| ATGATTGCCATTTTTGATGA | 148 | Immunomodulatory | 0.689 | 20 | 6137.09 | 43.58 | 30 |
| GGTTAATTCCTCTAATTTTT | 3 | Immunomodulatory | 0.662 | 20 | 6063.04 | 41.53 | 25 |
| CCGTATGATTGCCATTTTTG | 144 | Immunomodulatory | 0.63 | 20 | 6089.03 | 47.68 | 40 |
| ATAACTTGAAAGATAATCAA | 341 | Immunomodulatory | 0.609 | 20 | 6141.13 | 39.48 | 20 |
| TGTTAAAAATGATGGTTGGA | 320 | Immunomodulatory | 0.603 | 20 | 6235.17 | 43.58 | 30 |
| TATGATTGCCATTTTTGATG | 147 | Immunomodulatory | 0.601 | 20 | 6128.08 | 43.58 | 30 |
| TAACTTGAAAGATAATCAAC | 342 | Immunomodulatory | 0.595 | 20 | 6117.1 | 41.53 | 25 |