MucormyDB: A webportal for managing resources on Mucormycosis

  • Home
  • Genomics/Proteomics
    • Whole Genome
    • Protein Sequences
    • Nucleotide Sequences
  • Immunotherapy
    • siRNA based
    • Peptide based
    • Vaccine adjuvants
  • Drugs
    • Available Drugs
    • Potential Drug Molecules
    • 3-D Structure
  • Additional Info
    • Diagnosis
    • Literature
    • Video Lectures
    • Data Submission
    • FAQs
  • About
    • Team
    • Contact Us

  • Welcome to Vaccine adjuvants prediction page

    ----------------------------------------------------------------------------------------------------------------------------------------------------

    These are predicted oligodeoxynucleoides vaccine adjuvants related to ARP protein of Rhizopus oryzae.

    ------------------------------------------------------------------------------------------------------------------------------------------------------

         Click here to download
    SequenceStart PositionClassSVM ScoreLengthMol. Wt.TmGC content(%)
    ACGTTGTTTAGGTGATCGAC1086Immunomodulatory 1.355 20 6163.08 49.73 45
    ATGTCCCAGTTCGTCGAGGG1116Immunomodulatory 1.34 20 6149.04 55.88 60
    CGCTATCGATGAACTTGATC483Immunomodulatory 1.309 20 6092.03 49.73 45
    ATGGACGTTGTTTAGGTGAT1082Immunomodulatory 1.224 20 6218.13 47.68 40
    AAATGGACGTTGTTTAGGTG1080Immunomodulatory 1.17 20 6227.14 47.68 40
    AATGGACGTTGTTTAGGTGA1081Immunomodulatory 1.164 20 6227.14 47.68 40
    CAAGCTAAAAGTAGACATTT1177Immunomodulatory 1.129 20 6133.1 43.58 30
    CCAGTTCGTCGAGGGTAGTG1121Immunomodulatory 1.092 20 6189.07 55.88 60
    AGATACGTTGATTCCTTTTG213Immunomodulatory 1.091 20 6113.06 45.63 35
    ACAAGCTAAAAGTAGACATT1176Immunomodulatory 1.085 20 6142.11 43.58 30

IIIT Delhi

Raghava's group