Welcome to Vaccine adjuvants prediction page
----------------------------------------------------------------------------------------------------------------------------------------------------
These are predicted oligodeoxynucleoides vaccine adjuvants related toARF protein of Rhizopus oryzae.
------------------------------------------------------------------------------------------------------------------------------------------------------
Click here to download
| Sequence | Start Position | Class | SVM Score | Length | Mol. Wt. | Tm | GC content(%) |
| AATAGACAATATTCTATTTA | 436 | Immunomodulatory | 1.411 | 20 | 6098.1 | 37.43 | 15 |
| ATAGACAATATTCTATTTAT | 437 | Immunomodulatory | 1.355 | 20 | 6089.09 | 37.43 | 15 |
| GAATAGACAATATTCTATTT | 435 | Immunomodulatory | 1.265 | 20 | 6114.1 | 39.48 | 20 |
| TAGACAATATTCTATTTATA | 438 | Immunomodulatory | 1.201 | 20 | 6089.09 | 37.43 | 15 |
| AGAATAGACAATATTCTATT | 434 | Immunomodulatory | 1.144 | 20 | 6123.11 | 39.48 | 20 |
| AATATTCTATTTATAAGACA | 443 | Immunomodulatory | 1.096 | 20 | 6098.1 | 37.43 | 15 |
| ATACAAAAACATAAAATTTC | 171 | Immunomodulatory | 1.09 | 20 | 6085.1 | 37.43 | 15 |
| TAGTCTTTTTAGTAAACTTT | 18 | Immunomodulatory | 1.077 | 20 | 6087.07 | 39.48 | 20 |
| AAGAATAGACAATATTCTAT | 433 | Immunomodulatory | 1.075 | 20 | 6132.12 | 39.48 | 20 |
| GAGAAGTTGTTTCGACCATT | 119 | Immunomodulatory | 1.051 | 20 | 6147.08 | 47.68 | 40 |