MucormyDB: A webportal for managing resources on Mucormycosis

  • Home
  • Genomics/Proteomics
    • Whole Genome
    • Protein Sequences
    • Nucleotide Sequences
  • Immunotherapy
    • siRNA based
    • Peptide based
    • Vaccine adjuvants
  • Drugs
    • Available Drugs
    • Potential Drug Molecules
    • 3-D Structure
  • Additional Info
    • Diagnosis
    • Literature
    • Video Lectures
    • Data Submission
    • FAQs
  • About
    • Team
    • Contact Us

  • Welcome to Vaccine adjuvants prediction page

    ----------------------------------------------------------------------------------------------------------------------------------------------------

    These are predicted oligodeoxynucleoides vaccine adjuvants related toARF protein of Rhizopus oryzae.

    ------------------------------------------------------------------------------------------------------------------------------------------------------

         Click here to download
    SequenceStart PositionClassSVM ScoreLengthMol. Wt.TmGC content(%)
    AATAGACAATATTCTATTTA436Immunomodulatory 1.411 20 6098.1 37.43 15
    ATAGACAATATTCTATTTAT437Immunomodulatory 1.355 20 6089.09 37.43 15
    GAATAGACAATATTCTATTT435Immunomodulatory 1.265 20 6114.1 39.48 20
    TAGACAATATTCTATTTATA438Immunomodulatory 1.201 20 6089.09 37.43 15
    AGAATAGACAATATTCTATT434Immunomodulatory 1.144 20 6123.11 39.48 20
    AATATTCTATTTATAAGACA443Immunomodulatory 1.096 20 6098.1 37.43 15
    ATACAAAAACATAAAATTTC171Immunomodulatory 1.09 20 6085.1 37.43 15
    TAGTCTTTTTAGTAAACTTT18Immunomodulatory 1.077 20 6087.07 39.48 20
    AAGAATAGACAATATTCTAT433Immunomodulatory 1.075 20 6132.12 39.48 20
    GAGAAGTTGTTTCGACCATT119Immunomodulatory 1.051 20 6147.08 47.68 40

IIIT Delhi

Raghava's group