| DB ID | MyCo_5732 |
| Title | Development of a quantitative PCR detecting Cunninghamella bertholletiae to help in diagnosing this rare and aggressive mucormycosis |
| Year | 2018 |
| PMID | 29712993 |
| Fungal Diseases involved | Mucormycosis |
| Associated Medical Condition | Chronic lymphocytic leukemia |
| Genus | Cunninghamella |
| Species | bertholletiae |
| Organism | Cunninghamella bertholletiae |
| Ethical Statement | None |
| Site of Infection | None |
| Opportunistic invasive | Opportunistic |
| Sample type | Body fluid |
| Sample source | Serum |
| Host Group | Human |
| Host Common name | Human |
| Host Scientific name | Homo sapiens |
| Biomarker Name | (FAM)TCGGTCGGCGTGGTTCTCTGCCCA (TAMRA) |
| Biomarker Full Name | (FAM)TCGGTCGGCGTGGTTCTCTGCCCA (TAMRA) |
| Biomarker Type | Diagnostic |
| Biomolecule | Gene |
| Geographical Location | France |
| Cohort | In 2016, a 61-year-old man was diagnosed with stage-B chronic lymphocytic leukemia. He underwent a fourth chemotherapy cycle of rituximab, udarabine, and cyclo- sphosphamide (RFC) on 6th September (D0). On D21, he was admitted to the hematology unit for febrile aplasia. The fever persisted despite broad spectrum antibiotic therapy with piperacillin-tazobactam. |
| Cohort No. | 1 |
| Age Group | 61 |
| P Value | None |
| Sensitivity | None |
| Specificity | None |
| Positive Predictive Value | None |
| MIC | None |
| Fold Change | None |
| Pathway | None |
| Disease Introduction Mechanism | Mucormycosis is a frequently fatal invasive mold infection that has emerged in immunocompromised patients. Classic risk factors for developing mucormycosis are diabetes, systemic or local steroid use, immunosuppressive therapy for solid organ or stem cell transplantation, neutropenia, and deferoxamine therapy. High doses of liposomal amphotericine B, posaconazole and surgery are the recommended therapeutic options. However, mucormycosis is still associated with high mortality rates, speci cally in hematological patients. |
| Technique | PCR |
| Analysis Method | qRT-PCR |
| ELISA kits | None |
| Assay Data | None |
| Validation Techniques used | qRT-PCR |
| Up Regulation Down Regulation | Positive |
| Sequence Data | None |
| External Link | None |
