Cancertope

In silico Platform for designing genome-based
Personalized immunotherapy or Vaccine against Cancer

Browse Results ...


The result page of search shows exclusive peptide/epitopes generated due to mutation [Neoepitope], the tissue of origin [Tissue], position of peptide in protein [Position], number of mismatches counted by aligning mutated and normal protein sequence [Num Mismatch, percentage of cell lines with this peptide over total number of cell lines [Promiscuity %]. The immune information include CTL epitopes (Yes/No), MHC I binders, MHC II binders (both given as number of alleles) and B cell epitopes (Yes/No). For more information, please click HERE


Result Reset Search:
ProteinNeoepitopesTissuePositionProt MutationcDNA MutationMutation TypeNum MismatchPromiscuity (%)Cell LineCTLMHC INHLApredMHC IIBcell
TP53AAPAPAPPGENDOMETRIUM83p.P89fsc.267_267delCFrame_Shift_Del20.11AN3CAN000Y
TP53AAQIAMVWPSALIVARY_GLAND181p.E180fsc.539_539delAFrame_Shift_Del50.11A253N000N
TP53AATVSVWASENDOMETRIUM105p.P89fsc.267_267delCFrame_Shift_Del60.11AN3CAN100N
TP53ACPGETGAQLUNG276p.G279fsc.837_837delGFrame_Shift_Del50.11DMS79N000N
TP53AHPHHHHTGLARGE_INTESTINE245p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del60.11SW1417N000N
TP53AKPALCSCGLUNG138p.K139fsc.417_417delGFrame_Shift_Del60.11HCC1438N000N
TP53AKTCRAAVGOVARY138p.P142fsc.425_426delCTFrame_Shift_Del50.11SNU8N000N
TP53ALNKMFANWPANCREAS129p.C135fsc.403_403delTFrame_Shift_Del30.11ASPC1Y4140N
TP53ALNKMLPTGLUNG129p.F134fsc.402_403delTTFrame_Shift_Del40.11RERFLCMSN000N
TP53AMVWPLLSISALIVARY_GLAND185p.E180fsc.539_539delAFrame_Shift_Del40.11A253Y11110N
TP53ANWPRPALCPANCREAS135p.C135fsc.403_403delTFrame_Shift_Del60.11ASPC1Y0130N
TP53APAPAPPGPENDOMETRIUM84p.P89fsc.267_267delCFrame_Shift_Del20.11AN3CAN000N
TP53APAPPGPCHENDOMETRIUM86p.P89fsc.267_267delCFrame_Shift_Del40.11AN3CAY0150N
TP53APLSILSEWLUNG189p.P191fsc.572_572delCFrame_Shift_Del50.11NCIH522Y10110N
TP53APPGPCHLLENDOMETRIUM88p.P89fsc.267_267delCFrame_Shift_Del60.11AN3CAY2190N
TP53APPQKEICVOVARY189p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del30.1159MN1400N
TP53AQIAMVWPLSALIVARY_GLAND182p.E180fsc.539_539delAFrame_Shift_Del50.11A253N2200N
TP53ARPALCSCGPROSTATE138p.A138fsc.414_414delCFrame_Shift_Del60.11PC3N100N
TP53ASCILGQPSENDOMETRIUM112p.P89fsc.267_267delCFrame_Shift_Del60.11AN3CAN000N
TP53ATVSVWASCENDOMETRIUM106p.P89fsc.267_267delCFrame_Shift_Del60.11AN3CAY1100N
TP53CACPGETGALUNG275p.G279fsc.837_837delGFrame_Shift_Del40.11DMS79N300N
TP53CHLLSLPRKENDOMETRIUM93p.P89fsc.267_267delCFrame_Shift_Del60.11AN3CAN000N
TP53CPGETGAQRLUNG277p.G279fsc.837_837delGFrame_Shift_Del50.11DMS79N300N
TP53CPHHGAAQISALIVARY_GLAND176p.E180fsc.539_539delAFrame_Shift_Del50.11A253N1300N
TP53CQLAKPALCLUNG135p.K139fsc.417_417delGFrame_Shift_Del40.11HCC1438N200N
TP53CQLAKTCRAOVARY135p.P142fsc.425_426delCTFrame_Shift_Del20.11SNU8N300N
TP53CQLARPALCPROSTATE135p.A138fsc.414_414delCFrame_Shift_Del50.11PC3N200Y
TP53DGLAPLSILLUNG186p.P191fsc.572_572delCFrame_Shift_Del30.11NCIH522N1500N
TP53DGLAPPQKEOVARY186p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del20.1159MN000Y
TP53DGTALRCVFHAEMATOPOIETIC_AND_LYMPHOID_TISSUE266p.I251fsc.752_752delTFrame_Shift_Del60.11TF1N500N
TP53DSDGLAPLSLUNG184p.P191fsc.572_572delCFrame_Shift_Del20.11NCIH522N200N
TP53DSTPASAPWSOFT_TISSUE148p.P152fsc.454_466delCCGCCCGGCACCCFrame_Shift_Del50.11RH41N400N
TP53EAHPHHHHTLARGE_INTESTINE244p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del60.11SW1417N200N
TP53ELPQGALSEHAEMATOPOIETIC_AND_LYMPHOID_TISSUE298p.P301fsc.902_902delCFrame_Shift_Del50.11KCL22N000N
TP53ENNVLSPCRLUNG28p.P34fsc.102_102delCFrame_Shift_Del20.11LCLC97TM1N200N
TP53ENNVLSPLRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE28p.P36fsc.107_107delCFrame_Shift_Del10.11PL21N200N
TP53EPEAHPHHHLARGE_INTESTINE242p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del50.11SW1417N000N
TP53EPHHELPQGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE294p.P301fsc.902_902delCFrame_Shift_Del10.11KCL22N000N
TP53EYLDDKHFSUPPER_AERODIGESTIVE_TRACT204p.R209fsc.626_627delGAFrame_Shift_Del40.11SCC25N300N
TP53FANWPRPALPANCREAS134p.C135fsc.403_403delTFrame_Shift_Del60.11ASPC1Y1590N
TP53FCQLAKPALLUNG134p.K139fsc.417_417delGFrame_Shift_Del30.11HCC1438N704N
TP53FCQLAKTCROVARY134p.P142fsc.425_426delCTFrame_Shift_Del10.11SNU8N500N
TP53FCQLARPALPROSTATE134p.A138fsc.414_414delCFrame_Shift_Del40.11PC3N800Y
TP53GAAQIAMVWSALIVARY_GLAND180p.E180fsc.539_539delAFrame_Shift_Del60.11A253Y2110N
TP53GEPHHELPQHAEMATOPOIETIC_AND_LYMPHOID_TISSUE293p.P301fsc.902_902delCFrame_Shift_Del10.11KCL22N000N
TP53GGMNRRPTSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE244p.I251fsc.752_752delTFrame_Shift_Del20.11TF1N200N
TP53GLAPLSILSLUNG187p.P191fsc.572_572delCFrame_Shift_Del40.11NCIH522N000N
TP53GLAPPQKEIOVARY187p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del20.1159MN500N
TP53GMNRRPTSPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE245p.I251fsc.752_752delTFrame_Shift_Del30.11TF1N000N
TP53GNLLGRTALOESOPHAGUS262p.R267fsc.801_801delGFrame_Shift_Del30.11TE9Y8150N
TP53GPCHLLSLPENDOMETRIUM91p.P89fsc.267_267delCFrame_Shift_Del60.11AN3CAN000N
TP53GRHEPEAHPLARGE_INTESTINE239p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del50.11SW1417N100N
TP53GRTALRCVFOESOPHAGUS266p.R267fsc.801_801delGFrame_Shift_Del60.11TE9N400N
TP53GSDCTTIHVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE226p.I232fsc.696_706delCCACTACAACTFrame_Shift_Del10.11HDMYZY4100Y
TP53GTALRCVFVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE267p.I251fsc.752_752delTFrame_Shift_Del60.11TF1Y5110N
TP53HELPQGALSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE297p.P301fsc.902_902delCFrame_Shift_Del40.11KCL22N500Y
TP53HEPEAHPHHLARGE_INTESTINE241p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del50.11SW1417N000N
TP53HGAAQIAMVSALIVARY_GLAND179p.E180fsc.539_539delAFrame_Shift_Del60.11A253N700N
TP53HGRHEPEAHLARGE_INTESTINE238p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del60.11SW1417N100N
TP53HHELPQGALHAEMATOPOIETIC_AND_LYMPHOID_TISSUE296p.P301fsc.902_902delCFrame_Shift_Del30.11KCL22N400Y
TP53HHGAAQIAMSALIVARY_GLAND178p.E180fsc.539_539delAFrame_Shift_Del60.11A253N300N
TP53HLIRVKFACHAEMATOPOIETIC_AND_LYMPHOID_TISSUE193p.E198fsc.592_596delGAAGGFrame_Shift_Del40.11TOLEDON200N
TP53HLLSLPRKPENDOMETRIUM94p.P89fsc.267_267delCFrame_Shift_Del60.11AN3CAN000N
TP53HPHHHHTGRLARGE_INTESTINE246p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del60.11SW1417N400N
TP53HWKTPVVIYHAEMATOPOIETIC_AND_LYMPHOID_TISSUE256p.I251fsc.752_752delTFrame_Shift_Del60.11TF1Y3140N
TP53HYNYMHGRHLARGE_INTESTINE233p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del40.11SW1417N000N
TP53IAMVWPLLSSALIVARY_GLAND184p.E180fsc.539_539delAFrame_Shift_Del40.11A253N1032N
TP53IHYNYMHGRLARGE_INTESTINE232p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del30.11SW1417N100N
TP53IRVKFACGVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE195p.E198fsc.592_596delGAAGGFrame_Shift_Del50.11TOLEDOY8919N
TP53IYWDGTALRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE263p.I251fsc.752_752delTFrame_Shift_Del60.11TF1Y31011N
TP53KKKPGWRIFOVARY319p.P322fsc.966_967delACFrame_Shift_Del50.11COV504Y3120N
TP53KKPGWRIFHOVARY320p.P322fsc.966_967delACFrame_Shift_Del50.11COV504N100N
TP53KMFANWPRPPANCREAS132p.C135fsc.403_403delTFrame_Shift_Del60.11ASPC1N100N
TP53KMFCQLAKPLUNG132p.K139fsc.417_417delGFrame_Shift_Del10.11HCC1438N200N
TP53KMFCQLARPPROSTATE132p.A138fsc.414_414delCFrame_Shift_Del20.11PC3N200Y
TP53KMLPTGQDLLUNG132p.F134fsc.402_403delTTFrame_Shift_Del50.11RERFLCMSN1800N
TP53KPALCSCGLLUNG139p.K139fsc.417_417delGFrame_Shift_Del60.11HCC1438N1700N
TP53KPGWRIFHPOVARY321p.P322fsc.966_967delACFrame_Shift_Del60.11COV504N100N
TP53KPTRAATVSENDOMETRIUM101p.P89fsc.267_267delCFrame_Shift_Del50.11AN3CAN300N
TP53KTPVVIYWDHAEMATOPOIETIC_AND_LYMPHOID_TISSUE258p.I251fsc.752_752delTFrame_Shift_Del50.11TF1N100N
TP53LAKPALCSCLUNG137p.K139fsc.417_417delGFrame_Shift_Del60.11HCC1438N400N
TP53LAKTCRAAVOVARY137p.P142fsc.425_426delCTFrame_Shift_Del40.11SNU8N700N
TP53LAPLSILSELUNG188p.P191fsc.572_572delCFrame_Shift_Del50.11NCIH522N007N
TP53LAPPQKEICOVARY188p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del30.1159MN300N
TP53LARPALCSCPROSTATE137p.A138fsc.414_414delCFrame_Shift_Del60.11PC3N400N
TP53LGRTALRCVOESOPHAGUS265p.R267fsc.801_801delGFrame_Shift_Del60.11TE9N700N
TP53LIRVKFACGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE194p.E198fsc.592_596delGAAGGFrame_Shift_Del50.11TOLEDON000N
TP53LLGRTALRCOESOPHAGUS264p.R267fsc.801_801delGFrame_Shift_Del50.11TE9N2015N
TP53LLSILSEWKSALIVARY_GLAND190p.E180fsc.539_539delAFrame_Shift_Del60.11A253N407N
TP53LLSLPRKPTENDOMETRIUM95p.P89fsc.267_267delCFrame_Shift_Del60.11AN3CAN200N
TP53LNKMFANWPPANCREAS130p.C135fsc.403_403delTFrame_Shift_Del40.11ASPC1N002N
TP53LNKMLPTGQLUNG130p.F134fsc.402_403delTTFrame_Shift_Del50.11RERFLCMSN009N
TP53LPQGALSEHHAEMATOPOIETIC_AND_LYMPHOID_TISSUE299p.P301fsc.902_902delCFrame_Shift_Del60.11KCL22N100N
TP53LPRKPTRAAENDOMETRIUM98p.P89fsc.267_267delCFrame_Shift_Del40.11AN3CAN9013N
TP53LPTGQDLPCLUNG134p.F134fsc.402_403delTTFrame_Shift_Del60.11RERFLCMSN500N
TP53LRVEYLDDKUPPER_AERODIGESTIVE_TRACT201p.R209fsc.626_627delGAFrame_Shift_Del10.11SCC25N201N
TP53LSLPRKPTRENDOMETRIUM96p.P89fsc.267_267delCFrame_Shift_Del50.11AN3CAN400N
TP53LSPCRPKQWLUNG32p.P34fsc.102_102delCFrame_Shift_Del40.11LCLC97TM1N500N
TP53LSPLRPKQWHAEMATOPOIETIC_AND_LYMPHOID_TISSUE32p.P36fsc.107_107delCFrame_Shift_Del40.11PL21N500N
TP53LWVDSTPASSOFT_TISSUE145p.P152fsc.454_466delCCGCCCGGCACCCFrame_Shift_Del20.11RH41N0011N
TP53MFANWPRPAPANCREAS133p.C135fsc.403_403delTFrame_Shift_Del60.11ASPC1N2011N
TP53MFCQLAKPALUNG133p.K139fsc.417_417delGFrame_Shift_Del20.11HCC1438N301N
TP53MFCQLARPAPROSTATE133p.A138fsc.414_414delCFrame_Shift_Del30.11PC3N3011Y
TP53MGGMNRRPTHAEMATOPOIETIC_AND_LYMPHOID_TISSUE243p.I251fsc.752_752delTFrame_Shift_Del10.11TF1N2011N
TP53MHGRHEPEALARGE_INTESTINE237p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del60.11SW1417N200N
TP53MLPTGQDLPLUNG133p.F134fsc.402_403delTTFrame_Shift_Del60.11RERFLCMSN000N
TP53MNRRPTSPSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE246p.I251fsc.752_752delTFrame_Shift_Del40.11TF1N0018N
TP53MVWPLLSILSALIVARY_GLAND186p.E180fsc.539_539delAFrame_Shift_Del50.11A253Y2090N
TP53NKMFANWPRPANCREAS131p.C135fsc.403_403delTFrame_Shift_Del50.11ASPC1N200N
TP53NKMFCQLARPROSTATE131p.A138fsc.414_414delCFrame_Shift_Del10.11PC3N100Y
TP53NKMLPTGQDLUNG131p.F134fsc.402_403delTTFrame_Shift_Del60.11RERFLCMSN000N
TP53NLLGRTALROESOPHAGUS263p.R267fsc.801_801delGFrame_Shift_Del40.11TE9N500N
TP53NNVLSPCRPLUNG29p.P34fsc.102_102delCFrame_Shift_Del30.11LCLC97TM1N000N
TP53NNVLSPLRPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE29p.P36fsc.107_107delCFrame_Shift_Del20.11PL21N000N
TP53NRRPTSPSSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE247p.I251fsc.752_752delTFrame_Shift_Del50.11TF1N200N
TP53NVLSPCRPKLUNG30p.P34fsc.102_102delCFrame_Shift_Del40.11LCLC97TM1Y3100N
TP53NVLSPLRPKHAEMATOPOIETIC_AND_LYMPHOID_TISSUE30p.P36fsc.107_107delCFrame_Shift_Del30.11PL21Y3110N
TP53NWPRPALCSPANCREAS136p.C135fsc.403_403delTFrame_Shift_Del60.11ASPC1N000N
TP53NYMHGRHEPLARGE_INTESTINE235p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del60.11SW1417N000Y
TP53PAAPAPAPPENDOMETRIUM82p.P89fsc.267_267delCFrame_Shift_Del10.11AN3CAN000N
TP53PALNKMFANPANCREAS128p.C135fsc.403_403delTFrame_Shift_Del20.11ASPC1N000N
TP53PALNKMLPTLUNG128p.F134fsc.402_403delTTFrame_Shift_Del30.11RERFLCMSN000N
TP53PAPAPPGPCENDOMETRIUM85p.P89fsc.267_267delCFrame_Shift_Del30.11AN3CAN000N
TP53PAPPGPCHLENDOMETRIUM87p.P89fsc.267_267delCFrame_Shift_Del50.11AN3CAY190N
TP53PCHLLSLPRENDOMETRIUM92p.P89fsc.267_267delCFrame_Shift_Del60.11AN3CAN000N
TP53PCRPKQWMILUNG34p.P34fsc.102_102delCFrame_Shift_Del60.11LCLC97TM1N100N
TP53PEAHPHHHHLARGE_INTESTINE243p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del50.11SW1417N000N
TP53PENNVLSPCLUNG27p.P34fsc.102_102delCFrame_Shift_Del10.11LCLC97TM1N000N
TP53PGETGAQRKLUNG278p.G279fsc.837_837delGFrame_Shift_Del50.11DMS79N000N
TP53PGPCHLLSLENDOMETRIUM90p.P89fsc.267_267delCFrame_Shift_Del50.11AN3CAN100N
TP53PGWRIFHPSOVARY322p.P322fsc.966_967delACFrame_Shift_Del50.11COV504N000N
TP53PHHELPQGAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE295p.P301fsc.902_902delCFrame_Shift_Del20.11KCL22N000Y
TP53PHHGAAQIASALIVARY_GLAND177p.E180fsc.539_539delAFrame_Shift_Del60.11A253N000N
TP53PKKKPGWRIOVARY318p.P322fsc.966_967delACFrame_Shift_Del40.11COV504N100N
TP53PLLSILSEWSALIVARY_GLAND189p.E180fsc.539_539delAFrame_Shift_Del60.11A253N000N
TP53PLRPKQWMIHAEMATOPOIETIC_AND_LYMPHOID_TISSUE34p.P36fsc.107_107delCFrame_Shift_Del50.11PL21N200N
TP53PLSILSEWKLUNG190p.P191fsc.572_572delCFrame_Shift_Del60.11NCIH522N100N
TP53PPGPCHLLSENDOMETRIUM89p.P89fsc.267_267delCFrame_Shift_Del50.11AN3CAN000N
TP53PPQHLIRVKHAEMATOPOIETIC_AND_LYMPHOID_TISSUE190p.E198fsc.592_596delGAAGGFrame_Shift_Del10.11TOLEDON000N
TP53PPQKEICVWOVARY190p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del40.1159MN500N
TP53PQHLIRVKFHAEMATOPOIETIC_AND_LYMPHOID_TISSUE191p.E198fsc.592_596delGAAGGFrame_Shift_Del20.11TOLEDON300N
TP53PQKEICVWSOVARY191p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.1159MN000N
TP53PQPKKKPGWOVARY316p.P322fsc.966_967delACFrame_Shift_Del20.11COV504N000N
TP53PRKPTRAATENDOMETRIUM99p.P89fsc.267_267delCFrame_Shift_Del40.11AN3CAN100N
TP53PRPALCSCGPANCREAS138p.C135fsc.403_403delTFrame_Shift_Del60.11ASPC1N000N
TP53PSSHWKTPVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE253p.I251fsc.752_752delTFrame_Shift_Del50.11TF1N100Y
TP53PTRAATVSVENDOMETRIUM102p.P89fsc.267_267delCFrame_Shift_Del50.11AN3CAN000N
TP53PTSPSSHWKHAEMATOPOIETIC_AND_LYMPHOID_TISSUE250p.I251fsc.752_752delTFrame_Shift_Del50.11TF1N000N
TP53PVVIYWDGTHAEMATOPOIETIC_AND_LYMPHOID_TISSUE260p.I251fsc.752_752delTFrame_Shift_Del50.11TF1N000N
TP53QHLIRVKFAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE192p.E198fsc.592_596delGAAGGFrame_Shift_Del30.11TOLEDON300N
TP53QHMTEVVLRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE167p.R174fsc.520_545delAGGCGCTGCCCCCACCATGAGCGCTGFrame_Shift_Del10.11THP1N100N
TP53QIAMVWPLLSALIVARY_GLAND183p.E180fsc.539_539delAFrame_Shift_Del50.11A253N500N
TP53QKEICVWSIOVARY192p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.1159MN100N
TP53QLAKPALCSLUNG136p.K139fsc.417_417delGFrame_Shift_Del50.11HCC1438N000N
TP53QLAKTCRAAOVARY136p.P142fsc.425_426delCTFrame_Shift_Del30.11SNU8N100N
TP53QLARPALCSPROSTATE136p.A138fsc.414_414delCFrame_Shift_Del60.11PC3N000N
TP53QLWVDSTPASOFT_TISSUE144p.P152fsc.454_466delCCGCCCGGCACCCFrame_Shift_Del10.11RH41N500N
TP53QPKKKPGWROVARY317p.P322fsc.966_967delACFrame_Shift_Del30.11COV504N400Y
TP53RAATVSVWAENDOMETRIUM104p.P89fsc.267_267delCFrame_Shift_Del60.11AN3CAN500N
TP53RCPHHGAAQSALIVARY_GLAND175p.E180fsc.539_539delAFrame_Shift_Del40.11A253N000N
TP53RHEPEAHPHLARGE_INTESTINE240p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del50.11SW1417N000N
TP53RKPTRAATVENDOMETRIUM100p.P89fsc.267_267delCFrame_Shift_Del50.11AN3CAY690N
TP53RPTSPSSHWHAEMATOPOIETIC_AND_LYMPHOID_TISSUE249p.I251fsc.752_752delTFrame_Shift_Del60.11TF1N800N
TP53RRCPHHGAASALIVARY_GLAND174p.E180fsc.539_539delAFrame_Shift_Del30.11A253N300N
TP53RRPTSPSSHHAEMATOPOIETIC_AND_LYMPHOID_TISSUE248p.I251fsc.752_752delTFrame_Shift_Del60.11TF1N200N
TP53RTALRCVFVOESOPHAGUS267p.R267fsc.801_801delGFrame_Shift_Del60.11TE9Y5130N
TP53RVCACPGETLUNG273p.G279fsc.837_837delGFrame_Shift_Del20.11DMS79N100N
TP53RVEYLDDKHUPPER_AERODIGESTIVE_TRACT202p.R209fsc.626_627delGAFrame_Shift_Del20.11SCC25N200N
TP53RVKFACGVFHAEMATOPOIETIC_AND_LYMPHOID_TISSUE196p.E198fsc.592_596delGAAGGFrame_Shift_Del60.11TOLEDOY6110N
TP53SCILGQPSLENDOMETRIUM113p.P89fsc.267_267delCFrame_Shift_Del60.11AN3CAN900N
TP53SDGLAPLSILUNG185p.P191fsc.572_572delCFrame_Shift_Del30.11NCIH522N300N
TP53SDGLAPPQKOVARY185p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del10.1159MN000Y
TP53SDSDGLAPLLUNG183p.P191fsc.572_572delCFrame_Shift_Del10.11NCIH522N500N
TP53SGNLLGRTAOESOPHAGUS261p.R267fsc.801_801delGFrame_Shift_Del20.11TE9N100N
TP53SHWKTPVVIHAEMATOPOIETIC_AND_LYMPHOID_TISSUE255p.I251fsc.752_752delTFrame_Shift_Del50.11TF1N500N
TP53SLPRKPTRAENDOMETRIUM97p.P89fsc.267_267delCFrame_Shift_Del50.11AN3CAN400N
TP53SPALNKMFAPANCREAS127p.C135fsc.403_403delTFrame_Shift_Del10.11ASPC1N1000N
TP53SPALNKMLPLUNG127p.F134fsc.402_403delTTFrame_Shift_Del20.11RERFLCMSN000N
TP53SPCRPKQWMLUNG33p.P34fsc.102_102delCFrame_Shift_Del50.11LCLC97TM1Y1190N
TP53SPLRPKQWMHAEMATOPOIETIC_AND_LYMPHOID_TISSUE33p.P36fsc.107_107delCFrame_Shift_Del50.11PL21Y1290N
TP53SPQPKKKPGOVARY315p.P322fsc.966_967delACFrame_Shift_Del10.11COV504N100N
TP53SPSSHWKTPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE252p.I251fsc.752_752delTFrame_Shift_Del50.11TF1N000Y
TP53SQHMTEVVLHAEMATOPOIETIC_AND_LYMPHOID_TISSUE166p.R174fsc.520_545delAGGCGCTGCCCCCACCATGAGCGCTGFrame_Shift_Del10.11THP1N1000N
TP53SSGNLLGRTOESOPHAGUS260p.R267fsc.801_801delGFrame_Shift_Del10.11TE9N100N
TP53SSHWKTPVVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE254p.I251fsc.752_752delTFrame_Shift_Del50.11TF1N600N
TP53STPASAPWPSOFT_TISSUE149p.P152fsc.454_466delCCGCCCGGCACCCFrame_Shift_Del50.11RH41N000N
TP53SVWASCILGENDOMETRIUM109p.P89fsc.267_267delCFrame_Shift_Del60.11AN3CAN000N
TP53TFRHSVVVLLIVER211p.P219fsc.656_657delCCFrame_Shift_Del10.11SNU886Y590N
TP53TIHYNYMHGLARGE_INTESTINE231p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del20.11SW1417Y090N
TP53TPASAPWPSSOFT_TISSUE150p.P152fsc.454_466delCCGCCCGGCACCCFrame_Shift_Del40.11RH41N300N
TP53TPVVIYWDGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE259p.I251fsc.752_752delTFrame_Shift_Del60.11TF1N000N
TP53TRAATVSVWENDOMETRIUM103p.P89fsc.267_267delCFrame_Shift_Del60.11AN3CAY2140N
TP53TSPSSHWKTHAEMATOPOIETIC_AND_LYMPHOID_TISSUE251p.I251fsc.752_752delTFrame_Shift_Del50.11TF1N100N
TP53TTIHYNYMHLARGE_INTESTINE230p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del10.11SW1417N000N
TP53TVSVWASCIENDOMETRIUM107p.P89fsc.267_267delCFrame_Shift_Del60.11AN3CAN400N
TP53VCACPGETGLUNG274p.G279fsc.837_837delGFrame_Shift_Del30.11DMS79N000N
TP53VDSTPASAPSOFT_TISSUE147p.P152fsc.454_466delCCGCCCGGCACCCFrame_Shift_Del40.11RH41N000N
TP53VEYLDDKHFUPPER_AERODIGESTIVE_TRACT203p.R209fsc.626_627delGAFrame_Shift_Del30.11SCC25N900N
TP53VIYWDGTALHAEMATOPOIETIC_AND_LYMPHOID_TISSUE262p.I251fsc.752_752delTFrame_Shift_Del60.11TF1N1202N
TP53VKFACGVFGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE197p.E198fsc.592_596delGAAGGFrame_Shift_Del60.11TOLEDON002N
TP53VLSPCRPKQLUNG31p.P34fsc.102_102delCFrame_Shift_Del50.11LCLC97TM1N001N
TP53VLSPLRPKQHAEMATOPOIETIC_AND_LYMPHOID_TISSUE31p.P36fsc.107_107delCFrame_Shift_Del40.11PL21N001N
TP53VRRCPHHGASALIVARY_GLAND173p.E180fsc.539_539delAFrame_Shift_Del20.11A253N4023N
TP53VRVCACPGELUNG272p.G279fsc.837_837delGFrame_Shift_Del10.11DMS79N109N
TP53VSVWASCILENDOMETRIUM108p.P89fsc.267_267delCFrame_Shift_Del60.11AN3CAN1301N
TP53VVIYWDGTAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE261p.I251fsc.752_752delTFrame_Shift_Del60.11TF1N407N
TP53VVRRCPHHGSALIVARY_GLAND172p.E180fsc.539_539delAFrame_Shift_Del10.11A253N0018N
TP53VWASCILGQENDOMETRIUM110p.P89fsc.267_267delCFrame_Shift_Del50.11AN3CAN004N
TP53VWPLLSILSSALIVARY_GLAND187p.E180fsc.539_539delAFrame_Shift_Del50.11A253N0012N
TP53WASCILGQPENDOMETRIUM111p.P89fsc.267_267delCFrame_Shift_Del60.11AN3CAN200N
TP53WDGTALRCVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE265p.I251fsc.752_752delTFrame_Shift_Del60.11TF1N700N
TP53WKTPVVIYWHAEMATOPOIETIC_AND_LYMPHOID_TISSUE257p.I251fsc.752_752delTFrame_Shift_Del50.11TF1Y5110N
TP53WPLLSILSESALIVARY_GLAND188p.E180fsc.539_539delAFrame_Shift_Del50.11A253N307N
TP53WPRPALCSCPANCREAS137p.C135fsc.403_403delTFrame_Shift_Del60.11ASPC1Y9110N
TP53WVDSTPASASOFT_TISSUE146p.P152fsc.454_466delCCGCCCGGCACCCFrame_Shift_Del30.11RH41Y3104N
TP53YLDDKHFSTUPPER_AERODIGESTIVE_TRACT205p.R209fsc.626_627delGAFrame_Shift_Del50.11SCC25N500N
TP53YMHGRHEPELARGE_INTESTINE236p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del60.11SW1417N200N
TP53YNYMHGRHELARGE_INTESTINE234p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del50.11SW1417N2010Y
TP53YSPALNKMLLUNG126p.F134fsc.402_403delTTFrame_Shift_Del10.11RERFLCMSN1600N
TP53YWDGTALRCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE264p.I251fsc.752_752delTFrame_Shift_Del60.11TF1N200N
TP53ACPGRDRRRBREAST276p.T284fsc.851_852delCAFrame_Shift_Del10.22HCC202Y390N
TP53ACPGRDRRRSKIN276p.T284fsc.851_852delCAFrame_Shift_Del10.22SKMEL30Y390N
TP53ALRCVFVPVOESOPHAGUS269p.R267fsc.801_801delGFrame_Shift_Del60.22TE9Y8120N
TP53ALRCVFVPVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE269p.I251fsc.752_752delTFrame_Shift_Del60.22TF1Y8120N
TP53ASPRAAPREBREAST294p.T284fsc.851_852delCAFrame_Shift_Del50.22HCC202N000Y
TP53ASPRAAPRESKIN294p.T284fsc.851_852delCAFrame_Shift_Del50.22SKMEL30N000Y
TP53CPGRDRRRGBREAST277p.T284fsc.851_852delCAFrame_Shift_Del20.22HCC202N000N
TP53CPGRDRRRGSKIN277p.T284fsc.851_852delCAFrame_Shift_Del20.22SKMEL30N000N
TP53CVFVPVLGEOESOPHAGUS272p.R267fsc.801_801delGFrame_Shift_Del60.22TE9N000N
TP53CVFVPVLGEHAEMATOPOIETIC_AND_LYMPHOID_TISSUE272p.I251fsc.752_752delTFrame_Shift_Del60.22TF1N000N
TP53DRRRGRESPBREAST281p.T284fsc.851_852delCAFrame_Shift_Del50.22HCC202N000Y
TP53DRRRGRESPSKIN281p.T284fsc.851_852delCAFrame_Shift_Del50.22SKMEL30N000Y
TP53DYHHPLQLHSKIN228p.C229fsc.686_687delGTFrame_Shift_Del60.22IGR37N100N
TP53DYHHPLQLHSKIN228p.C229fsc.686_687delGTFrame_Shift_Del60.22IGR39N100N
TP53EPPEVGSDYSKIN221p.C229fsc.686_687delGTFrame_Shift_Del10.22IGR37N1100Y
TP53EPPEVGSDYSKIN221p.C229fsc.686_687delGTFrame_Shift_Del10.22IGR39N1100Y
TP53ERGASPRAABREAST291p.T284fsc.851_852delCAFrame_Shift_Del50.22HCC202N100N
TP53ERGASPRAASKIN291p.T284fsc.851_852delCAFrame_Shift_Del50.22SKMEL30N100N
TP53ESPQERGASBREAST287p.T284fsc.851_852delCAFrame_Shift_Del60.22HCC202N100N
TP53ESPQERGASSKIN287p.T284fsc.851_852delCAFrame_Shift_Del60.22SKMEL30N100N
TP53EVGSDYHHPSKIN224p.C229fsc.686_687delGTFrame_Shift_Del40.22IGR37N000N
TP53EVGSDYHHPSKIN224p.C229fsc.686_687delGTFrame_Shift_Del40.22IGR39N000N
TP53EWKEICVWSSALIVARY_GLAND196p.E180fsc.539_539delAFrame_Shift_Del60.22A253N000N
TP53EWKEICVWSLUNG196p.P191fsc.572_572delCFrame_Shift_Del60.22NCIH522N000N
TP53FVPVLGETGOESOPHAGUS274p.R267fsc.801_801delGFrame_Shift_Del60.22TE9N203N
TP53FVPVLGETGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE274p.I251fsc.752_752delTFrame_Shift_Del60.22TF1N203N
TP53GASPRAAPRBREAST293p.T284fsc.851_852delCAFrame_Shift_Del50.22HCC202Y490N
TP53GASPRAAPRSKIN293p.T284fsc.851_852delCAFrame_Shift_Del50.22SKMEL30Y490N
TP53GQDLPCAAVLUNG137p.F134fsc.402_403delTTFrame_Shift_Del60.22RERFLCMSY4100N
TP53GRDRRRGREBREAST279p.T284fsc.851_852delCAFrame_Shift_Del30.22HCC202N200Y
TP53GRDRRRGRESKIN279p.T284fsc.851_852delCAFrame_Shift_Del30.22SKMEL30N200Y
TP53GRESPQERGBREAST285p.T284fsc.851_852delCAFrame_Shift_Del50.22HCC202N100N
TP53GRESPQERGSKIN285p.T284fsc.851_852delCAFrame_Shift_Del50.22SKMEL30N100N
TP53GSDYHHPLQSKIN226p.C229fsc.686_687delGTFrame_Shift_Del50.22IGR37N100N
TP53GSDYHHPLQSKIN226p.C229fsc.686_687delGTFrame_Shift_Del50.22IGR39N100N
TP53HHHHTGRLQLARGE_INTESTINE248p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del70.22SW1417N000N
TP53HHHTGRLQWLARGE_INTESTINE249p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del70.22SW1417N300N
TP53ILSEWKEICSALIVARY_GLAND193p.E180fsc.539_539delAFrame_Shift_Del60.22A253N300N
TP53ILSEWKEICLUNG193p.P191fsc.572_572delCFrame_Shift_Del60.22NCIH522N300N
TP53LGETGAQRKOESOPHAGUS278p.R267fsc.801_801delGFrame_Shift_Del60.22TE9N100N
TP53LGETGAQRKHAEMATOPOIETIC_AND_LYMPHOID_TISSUE278p.I251fsc.752_752delTFrame_Shift_Del60.22TF1N100N
TP53LRCVFVPVLOESOPHAGUS270p.R267fsc.801_801delGFrame_Shift_Del60.22TE9Y101018N
TP53LRCVFVPVLHAEMATOPOIETIC_AND_LYMPHOID_TISSUE270p.I251fsc.752_752delTFrame_Shift_Del60.22TF1Y101018N
TP53LSEWKEICVSALIVARY_GLAND194p.E180fsc.539_539delAFrame_Shift_Del60.22A253N400N
TP53LSEWKEICVLUNG194p.P191fsc.572_572delCFrame_Shift_Del60.22NCIH522N400N
TP53LSILSEWKESALIVARY_GLAND191p.E180fsc.539_539delAFrame_Shift_Del60.22A253N000N
TP53LSILSEWKELUNG191p.P191fsc.572_572delCFrame_Shift_Del60.22NCIH522N000N
TP53PEVGSDYHHSKIN223p.C229fsc.686_687delGTFrame_Shift_Del30.22IGR37N000N
TP53PEVGSDYHHSKIN223p.C229fsc.686_687delGTFrame_Shift_Del30.22IGR39N000N
TP53PGRDRRRGRBREAST278p.T284fsc.851_852delCAFrame_Shift_Del30.22HCC202N000N
TP53PGRDRRRGRSKIN278p.T284fsc.851_852delCAFrame_Shift_Del30.22SKMEL30N000N
TP53PHHHHTGRLLARGE_INTESTINE247p.C238fsc.712_725delTGTAACAGTTCCTGFrame_Shift_Del60.22SW1417N200N
TP53PPEVGSDYHSKIN222p.C229fsc.686_687delGTFrame_Shift_Del20.22IGR37N000Y
TP53PPEVGSDYHSKIN222p.C229fsc.686_687delGTFrame_Shift_Del20.22IGR39N000Y
TP53PQERGASPRBREAST289p.T284fsc.851_852delCAFrame_Shift_Del60.22HCC202N000N
TP53PQERGASPRSKIN289p.T284fsc.851_852delCAFrame_Shift_Del60.22SKMEL30N000N
TP53PTGQDLPCALUNG135p.F134fsc.402_403delTTFrame_Shift_Del60.22RERFLCMSN000N
TP53PVLGETGAQOESOPHAGUS276p.R267fsc.801_801delGFrame_Shift_Del60.22TE9N000N
TP53PVLGETGAQHAEMATOPOIETIC_AND_LYMPHOID_TISSUE276p.I251fsc.752_752delTFrame_Shift_Del60.22TF1N000N
TP53QDLPCAAVGLUNG138p.F134fsc.402_403delTTFrame_Shift_Del60.22RERFLCMSN000N
TP53QERGASPRABREAST290p.T284fsc.851_852delCAFrame_Shift_Del60.22HCC202N500N
TP53QERGASPRASKIN290p.T284fsc.851_852delCAFrame_Shift_Del60.22SKMEL30N500N
TP53RCVFVPVLGOESOPHAGUS271p.R267fsc.801_801delGFrame_Shift_Del60.22TE9N000N
TP53RCVFVPVLGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE271p.I251fsc.752_752delTFrame_Shift_Del60.22TF1N000N
TP53RDRRRGRESBREAST280p.T284fsc.851_852delCAFrame_Shift_Del40.22HCC202N200N
TP53RDRRRGRESSKIN280p.T284fsc.851_852delCAFrame_Shift_Del40.22SKMEL30N200N
TP53RESPQERGABREAST286p.T284fsc.851_852delCAFrame_Shift_Del60.22HCC202N600N
TP53RESPQERGASKIN286p.T284fsc.851_852delCAFrame_Shift_Del60.22SKMEL30N600N
TP53RGASPRAAPBREAST292p.T284fsc.851_852delCAFrame_Shift_Del50.22HCC202N000N
TP53RGASPRAAPSKIN292p.T284fsc.851_852delCAFrame_Shift_Del50.22SKMEL30N000N
TP53RGRESPQERBREAST284p.T284fsc.851_852delCAFrame_Shift_Del50.22HCC202N000N
TP53RGRESPQERSKIN284p.T284fsc.851_852delCAFrame_Shift_Del50.22SKMEL30N000N
TP53RPALCSCGLPANCREAS139p.C135fsc.403_403delTFrame_Shift_Del50.22ASPC1N1700N
TP53RPALCSCGLPROSTATE139p.A138fsc.414_414delCFrame_Shift_Del50.22PC3N1700N
TP53RRGRESPQEBREAST283p.T284fsc.851_852delCAFrame_Shift_Del50.22HCC202N200N
TP53RRGRESPQESKIN283p.T284fsc.851_852delCAFrame_Shift_Del50.22SKMEL30N200N
TP53RRRGRESPQBREAST282p.T284fsc.851_852delCAFrame_Shift_Del50.22HCC202N300N
TP53RRRGRESPQSKIN282p.T284fsc.851_852delCAFrame_Shift_Del50.22SKMEL30N300N
TP53SDYHHPLQLSKIN227p.C229fsc.686_687delGTFrame_Shift_Del50.22IGR37N700N
TP53SDYHHPLQLSKIN227p.C229fsc.686_687delGTFrame_Shift_Del50.22IGR39N700N
TP53SEWKEICVWSALIVARY_GLAND195p.E180fsc.539_539delAFrame_Shift_Del70.22A253N600N
TP53SEWKEICVWLUNG195p.P191fsc.572_572delCFrame_Shift_Del70.22NCIH522N600N
TP53SILSEWKEISALIVARY_GLAND192p.E180fsc.539_539delAFrame_Shift_Del60.22A253N700N
TP53SILSEWKEILUNG192p.P191fsc.572_572delCFrame_Shift_Del60.22NCIH522N700N
TP53SPQERGASPBREAST288p.T284fsc.851_852delCAFrame_Shift_Del60.22HCC202N000N
TP53SPQERGASPSKIN288p.T284fsc.851_852delCAFrame_Shift_Del60.22SKMEL30N000N
TP53SPRAAPREHBREAST295p.T284fsc.851_852delCAFrame_Shift_Del50.22HCC202N000N
TP53SPRAAPREHSKIN295p.T284fsc.851_852delCAFrame_Shift_Del50.22SKMEL30N000N
TP53TALRCVFVPOESOPHAGUS268p.R267fsc.801_801delGFrame_Shift_Del50.22TE9N000N
TP53TALRCVFVPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE268p.I251fsc.752_752delTFrame_Shift_Del50.22TF1N000N
TP53TGQDLPCAALUNG136p.F134fsc.402_403delTTFrame_Shift_Del60.22RERFLCMSN100N
TP53VFVPVLGETOESOPHAGUS273p.R267fsc.801_801delGFrame_Shift_Del50.22TE9N100N
TP53VFVPVLGETHAEMATOPOIETIC_AND_LYMPHOID_TISSUE273p.I251fsc.752_752delTFrame_Shift_Del50.22TF1N100N
TP53VGSDYHHPLSKIN225p.C229fsc.686_687delGTFrame_Shift_Del50.22IGR37N1300N
TP53VGSDYHHPLSKIN225p.C229fsc.686_687delGTFrame_Shift_Del50.22IGR39N1300N
TP53VLGETGAQROESOPHAGUS277p.R267fsc.801_801delGFrame_Shift_Del60.22TE9N500N
TP53VLGETGAQRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE277p.I251fsc.752_752delTFrame_Shift_Del60.22TF1N500N
TP53VPVLGETGAOESOPHAGUS275p.R267fsc.801_801delGFrame_Shift_Del60.22TE9N1000N
TP53VPVLGETGAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE275p.I251fsc.752_752delTFrame_Shift_Del60.22TF1N1000N
TP53WKEICVWSISALIVARY_GLAND197p.E180fsc.539_539delAFrame_Shift_Del60.22A253N405N
TP53WKEICVWSILUNG197p.P191fsc.572_572delCFrame_Shift_Del60.22NCIH522N405N
TP53YHHPLQLHVSKIN229p.C229fsc.686_687delGTFrame_Shift_Del50.22IGR37N600N
TP53YHHPLQLHVSKIN229p.C229fsc.686_687delGTFrame_Shift_Del50.22IGR39N600N
TP53ALCSCGLIPPANCREAS141p.C135fsc.403_403delTFrame_Shift_Del50.33ASPC1N100N
TP53ALCSCGLIPLUNG141p.K139fsc.417_417delGFrame_Shift_Del50.33HCC1438N100N
TP53ALCSCGLIPPROSTATE141p.A138fsc.414_414delCFrame_Shift_Del50.33PC3N100N
TP53ALTVPPSTTOVARY221p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MN200N
TP53ALTVPPSTTSALIVARY_GLAND226p.E180fsc.539_539delAFrame_Shift_Del50.33A253N200N
TP53ALTVPPSTTLUNG226p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522N200N
TP53AQRKRISARLUNG283p.G279fsc.837_837delGFrame_Shift_Del60.33DMS79Y5100Y
TP53AQRKRISAROESOPHAGUS283p.R267fsc.801_801delGFrame_Shift_Del60.33TE9Y5100Y
TP53AQRKRISARHAEMATOPOIETIC_AND_LYMPHOID_TISSUE283p.I251fsc.752_752delTFrame_Shift_Del60.33TF1Y5100Y
TP53ARKGSLTTSLUNG290p.G279fsc.837_837delGFrame_Shift_Del60.33DMS79N300Y
TP53ARKGSLTTSOESOPHAGUS290p.R267fsc.801_801delGFrame_Shift_Del60.33TE9N300Y
TP53ARKGSLTTSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE290p.I251fsc.752_752delTFrame_Shift_Del60.33TF1N300Y
TP53CGLIPHPRPPANCREAS145p.C135fsc.403_403delTFrame_Shift_Del60.33ASPC1N000N
TP53CGLIPHPRPLUNG145p.K139fsc.417_417delGFrame_Shift_Del60.33HCC1438N000N
TP53CGLIPHPRPPROSTATE145p.A138fsc.414_414delCFrame_Shift_Del60.33PC3N000N
TP53CPMSRLRLAOVARY213p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MN1100N
TP53CPMSRLRLASALIVARY_GLAND218p.E180fsc.539_539delAFrame_Shift_Del60.33A253N1100N
TP53CPMSRLRLALUNG218p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522N1100N
TP53CPQGALSEHLUNG299p.G279fsc.837_837delGFrame_Shift_Del60.33DMS79N000N
TP53CPQGALSEHOESOPHAGUS299p.R267fsc.801_801delGFrame_Shift_Del60.33TE9N000N
TP53CPQGALSEHHAEMATOPOIETIC_AND_LYMPHOID_TISSUE299p.I251fsc.752_752delTFrame_Shift_Del60.33TF1N000N
TP53CSCGLIPHPPANCREAS143p.C135fsc.403_403delTFrame_Shift_Del50.33ASPC1N000N
TP53CSCGLIPHPLUNG143p.K139fsc.417_417delGFrame_Shift_Del50.33HCC1438N000N
TP53CSCGLIPHPPROSTATE143p.A138fsc.414_414delCFrame_Shift_Del50.33PC3N000N
TP53CVTVPAWAAOVARY232p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MN100N
TP53CVTVPAWAASALIVARY_GLAND237p.E180fsc.539_539delAFrame_Shift_Del50.33A253N100N
TP53CVTVPAWAALUNG237p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522N100N
TP53CVWSIWMTEOVARY196p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MN000N
TP53CVWSIWMTESALIVARY_GLAND201p.E180fsc.539_539delAFrame_Shift_Del50.33A253N000N
TP53CVWSIWMTELUNG201p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522N000N
TP53DIVWWCPMSOVARY208p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MN100N
TP53DIVWWCPMSSALIVARY_GLAND213p.E180fsc.539_539delAFrame_Shift_Del60.33A253N100N
TP53DIVWWCPMSLUNG213p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522N100N
TP53EICVWSIWMOVARY194p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MN200N
TP53EICVWSIWMSALIVARY_GLAND199p.E180fsc.539_539delAFrame_Shift_Del60.33A253N200N
TP53EICVWSIWMLUNG199p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522N200N
TP53ETGAQRKRILUNG280p.G279fsc.837_837delGFrame_Shift_Del60.33DMS79N400N
TP53ETGAQRKRIOESOPHAGUS280p.R267fsc.801_801delGFrame_Shift_Del60.33TE9N400N
TP53ETGAQRKRIHAEMATOPOIETIC_AND_LYMPHOID_TISSUE280p.I251fsc.752_752delTFrame_Shift_Del60.33TF1N400N
TP53ETLFDIVWWOVARY204p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MY1110N
TP53ETLFDIVWWSALIVARY_GLAND209p.E180fsc.539_539delAFrame_Shift_Del60.33A253Y1110N
TP53ETLFDIVWWLUNG209p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522Y1110N
TP53FDIVWWCPMOVARY207p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MN900N
TP53FDIVWWCPMSALIVARY_GLAND212p.E180fsc.539_539delAFrame_Shift_Del60.33A253N900N
TP53FDIVWWCPMLUNG212p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522N900N
TP53GAQRKRISALUNG282p.G279fsc.837_837delGFrame_Shift_Del60.33DMS79N200N
TP53GAQRKRISAOESOPHAGUS282p.R267fsc.801_801delGFrame_Shift_Del60.33TE9N200N
TP53GAQRKRISAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE282p.I251fsc.752_752delTFrame_Shift_Del60.33TF1N200N
TP53GETGAQRKRLUNG279p.G279fsc.837_837delGFrame_Shift_Del60.33DMS79N000N
TP53GETGAQRKROESOPHAGUS279p.R267fsc.801_801delGFrame_Shift_Del60.33TE9N000N
TP53GETGAQRKRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE279p.I251fsc.752_752delTFrame_Shift_Del60.33TF1N000N
TP53GLIPHPRPAPANCREAS146p.C135fsc.403_403delTFrame_Shift_Del50.33ASPC1N200N
TP53GLIPHPRPALUNG146p.K139fsc.417_417delGFrame_Shift_Del50.33HCC1438N200N
TP53GLIPHPRPAPROSTATE146p.A138fsc.414_414delCFrame_Shift_Del50.33PC3N200N
TP53GSLTTSCPQLUNG293p.G279fsc.837_837delGFrame_Shift_Del50.33DMS79N000N
TP53GSLTTSCPQOESOPHAGUS293p.R267fsc.801_801delGFrame_Shift_Del50.33TE9N000N
TP53GSLTTSCPQHAEMATOPOIETIC_AND_LYMPHOID_TISSUE293p.I251fsc.752_752delTFrame_Shift_Del50.33TF1N000N
TP53GWRIFHPSDOVARY323p.P322fsc.966_967delACFrame_Shift_Del60.33COV504N000N
TP53HPRPAPASAPANCREAS150p.C135fsc.403_403delTFrame_Shift_Del40.33ASPC1N900N
TP53HPRPAPASALUNG150p.K139fsc.417_417delGFrame_Shift_Del40.33HCC1438N900N
TP53HPRPAPASAPROSTATE150p.A138fsc.414_414delCFrame_Shift_Del40.33PC3N900N
TP53ICVWSIWMTOVARY195p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MN001N
TP53ICVWSIWMTSALIVARY_GLAND200p.E180fsc.539_539delAFrame_Shift_Del50.33A253N001N
TP53ICVWSIWMTLUNG200p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522N001N
TP53IFHPSDPWAOVARY326p.P322fsc.966_967delACFrame_Shift_Del60.33COV504N200N
TP53IPHPRPAPAPANCREAS148p.C135fsc.403_403delTFrame_Shift_Del40.33ASPC1Y9110N
TP53IPHPRPAPALUNG148p.K139fsc.417_417delGFrame_Shift_Del40.33HCC1438Y9110N
TP53IPHPRPAPAPROSTATE148p.A138fsc.414_414delCFrame_Shift_Del40.33PC3Y9110N
TP53ISARKGSLTLUNG288p.G279fsc.837_837delGFrame_Shift_Del60.33DMS79N100N
TP53ISARKGSLTOESOPHAGUS288p.R267fsc.801_801delGFrame_Shift_Del60.33TE9N100N
TP53ISARKGSLTHAEMATOPOIETIC_AND_LYMPHOID_TISSUE288p.I251fsc.752_752delTFrame_Shift_Del60.33TF1N100N
TP53IVWWCPMSROVARY209p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MY7921N
TP53IVWWCPMSRSALIVARY_GLAND214p.E180fsc.539_539delAFrame_Shift_Del60.33A253Y7921N
TP53IVWWCPMSRLUNG214p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522Y7921N
TP53IWMTETLFDOVARY200p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MN007N
TP53IWMTETLFDSALIVARY_GLAND205p.E180fsc.539_539delAFrame_Shift_Del50.33A253N007N
TP53IWMTETLFDLUNG205p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522N007N
TP53KEICVWSIWOVARY193p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MY8100N
TP53KEICVWSIWSALIVARY_GLAND198p.E180fsc.539_539delAFrame_Shift_Del60.33A253Y8100N
TP53KEICVWSIWLUNG198p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522Y8100N
TP53KGSLTTSCPLUNG292p.G279fsc.837_837delGFrame_Shift_Del60.33DMS79N000N
TP53KGSLTTSCPOESOPHAGUS292p.R267fsc.801_801delGFrame_Shift_Del60.33TE9N000N
TP53KGSLTTSCPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE292p.I251fsc.752_752delTFrame_Shift_Del60.33TF1N000N
TP53KRISARKGSLUNG286p.G279fsc.837_837delGFrame_Shift_Del60.33DMS79N300N
TP53KRISARKGSOESOPHAGUS286p.R267fsc.801_801delGFrame_Shift_Del60.33TE9N300N
TP53KRISARKGSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE286p.I251fsc.752_752delTFrame_Shift_Del60.33TF1N300N
TP53LALTVPPSTOVARY220p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MN400N
TP53LALTVPPSTSALIVARY_GLAND225p.E180fsc.539_539delAFrame_Shift_Del50.33A253N400N
TP53LALTVPPSTLUNG225p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522N400N
TP53LCSCGLIPHPANCREAS142p.C135fsc.403_403delTFrame_Shift_Del50.33ASPC1N000N
TP53LCSCGLIPHLUNG142p.K139fsc.417_417delGFrame_Shift_Del50.33HCC1438N000N
TP53LCSCGLIPHPROSTATE142p.A138fsc.414_414delCFrame_Shift_Del50.33PC3N000N
TP53LFDIVWWCPOVARY206p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MN000N
TP53LFDIVWWCPSALIVARY_GLAND211p.E180fsc.539_539delAFrame_Shift_Del60.33A253N000N
TP53LFDIVWWCPLUNG211p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522N000N
TP53LIPHPRPAPPANCREAS147p.C135fsc.403_403delTFrame_Shift_Del50.33ASPC1N008N
TP53LIPHPRPAPLUNG147p.K139fsc.417_417delGFrame_Shift_Del50.33HCC1438N008N
TP53LIPHPRPAPPROSTATE147p.A138fsc.414_414delCFrame_Shift_Del50.33PC3N008N
TP53LRLALTVPPOVARY218p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MN1036N
TP53LRLALTVPPSALIVARY_GLAND223p.E180fsc.539_539delAFrame_Shift_Del50.33A253N1036N
TP53LRLALTVPPLUNG223p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522N1036N
TP53LTTSCPQGALUNG295p.G279fsc.837_837delGFrame_Shift_Del50.33DMS79N200N
TP53LTTSCPQGAOESOPHAGUS295p.R267fsc.801_801delGFrame_Shift_Del50.33TE9N200N
TP53LTTSCPQGAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE295p.I251fsc.752_752delTFrame_Shift_Del50.33TF1N200N
TP53LTVPPSTTTOVARY222p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MN200N
TP53LTVPPSTTTSALIVARY_GLAND227p.E180fsc.539_539delAFrame_Shift_Del50.33A253N200N
TP53LTVPPSTTTLUNG227p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522N200N
TP53MSRLRLALTOVARY215p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MN200N
TP53MSRLRLALTSALIVARY_GLAND220p.E180fsc.539_539delAFrame_Shift_Del60.33A253N200N
TP53MSRLRLALTLUNG220p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522N200N
TP53MTETLFDIVOVARY202p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MN500N
TP53MTETLFDIVSALIVARY_GLAND207p.E180fsc.539_539delAFrame_Shift_Del60.33A253N500N
TP53MTETLFDIVLUNG207p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522N500N
TP53PALCSCGLIPANCREAS140p.C135fsc.403_403delTFrame_Shift_Del60.33ASPC1N300N
TP53PALCSCGLILUNG140p.K139fsc.417_417delGFrame_Shift_Del60.33HCC1438N300N
TP53PALCSCGLIPROSTATE140p.A138fsc.414_414delCFrame_Shift_Del60.33PC3N300N
TP53PHPRPAPASPANCREAS149p.C135fsc.403_403delTFrame_Shift_Del40.33ASPC1N000N
TP53PHPRPAPASLUNG149p.K139fsc.417_417delGFrame_Shift_Del40.33HCC1438N000N
TP53PHPRPAPASPROSTATE149p.A138fsc.414_414delCFrame_Shift_Del40.33PC3N000N
TP53PMSRLRLALOVARY214p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MN300N
TP53PMSRLRLALSALIVARY_GLAND219p.E180fsc.539_539delAFrame_Shift_Del60.33A253N300N
TP53PMSRLRLALLUNG219p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522N300N
TP53PPSTTTTCVOVARY225p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MN700N
TP53PPSTTTTCVSALIVARY_GLAND230p.E180fsc.539_539delAFrame_Shift_Del60.33A253N700N
TP53PPSTTTTCVLUNG230p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522N700N
TP53PSTTTTCVTOVARY226p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MN000N
TP53PSTTTTCVTSALIVARY_GLAND231p.E180fsc.539_539delAFrame_Shift_Del50.33A253N000N
TP53PSTTTTCVTLUNG231p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522N000N
TP53QRKRISARKLUNG284p.G279fsc.837_837delGFrame_Shift_Del60.33DMS79Y2120N
TP53QRKRISARKOESOPHAGUS284p.R267fsc.801_801delGFrame_Shift_Del60.33TE9Y2120N
TP53QRKRISARKHAEMATOPOIETIC_AND_LYMPHOID_TISSUE284p.I251fsc.752_752delTFrame_Shift_Del60.33TF1Y2120N
TP53RIFHPSDPWOVARY325p.P322fsc.966_967delACFrame_Shift_Del60.33COV504N400N
TP53RISARKGSLLUNG287p.G279fsc.837_837delGFrame_Shift_Del60.33DMS79Y9130N
TP53RISARKGSLOESOPHAGUS287p.R267fsc.801_801delGFrame_Shift_Del60.33TE9Y9130N
TP53RISARKGSLHAEMATOPOIETIC_AND_LYMPHOID_TISSUE287p.I251fsc.752_752delTFrame_Shift_Del60.33TF1Y9130N
TP53RKGSLTTSCLUNG291p.G279fsc.837_837delGFrame_Shift_Del60.33DMS79N100N
TP53RKGSLTTSCOESOPHAGUS291p.R267fsc.801_801delGFrame_Shift_Del60.33TE9N100N
TP53RKGSLTTSCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE291p.I251fsc.752_752delTFrame_Shift_Del60.33TF1N100N
TP53RKRISARKGLUNG285p.G279fsc.837_837delGFrame_Shift_Del60.33DMS79N100N
TP53RKRISARKGOESOPHAGUS285p.R267fsc.801_801delGFrame_Shift_Del60.33TE9N100N
TP53RKRISARKGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE285p.I251fsc.752_752delTFrame_Shift_Del60.33TF1N100N
TP53RLALTVPPSOVARY219p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MN000N
TP53RLALTVPPSSALIVARY_GLAND224p.E180fsc.539_539delAFrame_Shift_Del50.33A253N000N
TP53RLALTVPPSLUNG224p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522N000N
TP53RLRLALTVPOVARY217p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MN000N
TP53RLRLALTVPSALIVARY_GLAND222p.E180fsc.539_539delAFrame_Shift_Del50.33A253N000N
TP53RLRLALTVPLUNG222p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522N000N
TP53SARKGSLTTLUNG289p.G279fsc.837_837delGFrame_Shift_Del60.33DMS79N400Y
TP53SARKGSLTTOESOPHAGUS289p.R267fsc.801_801delGFrame_Shift_Del60.33TE9N400Y
TP53SARKGSLTTHAEMATOPOIETIC_AND_LYMPHOID_TISSUE289p.I251fsc.752_752delTFrame_Shift_Del60.33TF1N400Y
TP53SCGLIPHPRPANCREAS144p.C135fsc.403_403delTFrame_Shift_Del50.33ASPC1N300N
TP53SCGLIPHPRLUNG144p.K139fsc.417_417delGFrame_Shift_Del50.33HCC1438N300N
TP53SCGLIPHPRPROSTATE144p.A138fsc.414_414delCFrame_Shift_Del50.33PC3N300N
TP53SCPQGALSELUNG298p.G279fsc.837_837delGFrame_Shift_Del60.33DMS79N000N
TP53SCPQGALSEOESOPHAGUS298p.R267fsc.801_801delGFrame_Shift_Del60.33TE9N000N
TP53SCPQGALSEHAEMATOPOIETIC_AND_LYMPHOID_TISSUE298p.I251fsc.752_752delTFrame_Shift_Del60.33TF1N000N
TP53SIWMTETLFOVARY199p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MN400N
TP53SIWMTETLFSALIVARY_GLAND204p.E180fsc.539_539delAFrame_Shift_Del50.33A253N400N
TP53SIWMTETLFLUNG204p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522N400N
TP53SLTTSCPQGLUNG294p.G279fsc.837_837delGFrame_Shift_Del50.33DMS79N000N
TP53SLTTSCPQGOESOPHAGUS294p.R267fsc.801_801delGFrame_Shift_Del50.33TE9N000N
TP53SLTTSCPQGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE294p.I251fsc.752_752delTFrame_Shift_Del50.33TF1N000N
TP53SRLRLALTVOVARY216p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MY4100N
TP53SRLRLALTVSALIVARY_GLAND221p.E180fsc.539_539delAFrame_Shift_Del60.33A253Y4100N
TP53SRLRLALTVLUNG221p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522Y4100N
TP53STTTTCVTVOVARY227p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MY390N
TP53STTTTCVTVSALIVARY_GLAND232p.E180fsc.539_539delAFrame_Shift_Del50.33A253Y390N
TP53STTTTCVTVLUNG232p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522Y390N
TP53TCVTVPAWAOVARY231p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MN200N
TP53TCVTVPAWASALIVARY_GLAND236p.E180fsc.539_539delAFrame_Shift_Del50.33A253N200N
TP53TCVTVPAWALUNG236p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522N200N
TP53TETLFDIVWOVARY203p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MY690N
TP53TETLFDIVWSALIVARY_GLAND208p.E180fsc.539_539delAFrame_Shift_Del60.33A253Y690N
TP53TETLFDIVWLUNG208p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522Y690N
TP53TGAQRKRISLUNG281p.G279fsc.837_837delGFrame_Shift_Del60.33DMS79N100N
TP53TGAQRKRISOESOPHAGUS281p.R267fsc.801_801delGFrame_Shift_Del60.33TE9N100N
TP53TGAQRKRISHAEMATOPOIETIC_AND_LYMPHOID_TISSUE281p.I251fsc.752_752delTFrame_Shift_Del60.33TF1N100N
TP53TLFDIVWWCOVARY205p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MY6120N
TP53TLFDIVWWCSALIVARY_GLAND210p.E180fsc.539_539delAFrame_Shift_Del60.33A253Y6120N
TP53TLFDIVWWCLUNG210p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522Y6120N
TP53TSCPQGALSLUNG297p.G279fsc.837_837delGFrame_Shift_Del60.33DMS79N000N
TP53TSCPQGALSOESOPHAGUS297p.R267fsc.801_801delGFrame_Shift_Del60.33TE9N000N
TP53TSCPQGALSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE297p.I251fsc.752_752delTFrame_Shift_Del60.33TF1N000N
TP53TTCVTVPAWOVARY230p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MY1120N
TP53TTCVTVPAWSALIVARY_GLAND235p.E180fsc.539_539delAFrame_Shift_Del50.33A253Y1120N
TP53TTCVTVPAWLUNG235p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522Y1120N
TP53TTSCPQGALLUNG296p.G279fsc.837_837delGFrame_Shift_Del50.33DMS79N400N
TP53TTSCPQGALOESOPHAGUS296p.R267fsc.801_801delGFrame_Shift_Del50.33TE9N400N
TP53TTSCPQGALHAEMATOPOIETIC_AND_LYMPHOID_TISSUE296p.I251fsc.752_752delTFrame_Shift_Del50.33TF1N400N
TP53TTTCVTVPAOVARY229p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MN200N
TP53TTTCVTVPASALIVARY_GLAND234p.E180fsc.539_539delAFrame_Shift_Del50.33A253N200N
TP53TTTCVTVPALUNG234p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522N200N
TP53TTTTCVTVPOVARY228p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MN000N
TP53TTTTCVTVPSALIVARY_GLAND233p.E180fsc.539_539delAFrame_Shift_Del50.33A253N000N
TP53TTTTCVTVPLUNG233p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522N000N
TP53TVPPSTTTTOVARY223p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MN200N
TP53TVPPSTTTTSALIVARY_GLAND228p.E180fsc.539_539delAFrame_Shift_Del50.33A253N200N
TP53TVPPSTTTTLUNG228p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522N200N
TP53VPPSTTTTCOVARY224p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MN600N
TP53VPPSTTTTCSALIVARY_GLAND229p.E180fsc.539_539delAFrame_Shift_Del60.33A253N600N
TP53VPPSTTTTCLUNG229p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522N600N
TP53VWSIWMTETOVARY197p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MN000N
TP53VWSIWMTETSALIVARY_GLAND202p.E180fsc.539_539delAFrame_Shift_Del50.33A253N000N
TP53VWSIWMTETLUNG202p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522N000N
TP53VWWCPMSRLOVARY210p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MN1000N
TP53VWWCPMSRLSALIVARY_GLAND215p.E180fsc.539_539delAFrame_Shift_Del60.33A253N1000N
TP53VWWCPMSRLLUNG215p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522N1000N
TP53WCPMSRLRLOVARY212p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MN9020N
TP53WCPMSRLRLSALIVARY_GLAND217p.E180fsc.539_539delAFrame_Shift_Del60.33A253N9020N
TP53WCPMSRLRLLUNG217p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522N9020N
TP53WMTETLFDIOVARY201p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MN1202N
TP53WMTETLFDISALIVARY_GLAND206p.E180fsc.539_539delAFrame_Shift_Del60.33A253N1202N
TP53WMTETLFDILUNG206p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522N1202N
TP53WRIFHPSDPOVARY324p.P322fsc.966_967delACFrame_Shift_Del60.33COV504N2033N
TP53WSIWMTETLOVARY198p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del50.3359MY16114N
TP53WSIWMTETLSALIVARY_GLAND203p.E180fsc.539_539delAFrame_Shift_Del50.33A253Y16114N
TP53WSIWMTETLLUNG203p.P191fsc.572_572delCFrame_Shift_Del50.33NCIH522Y16114N
TP53WWCPMSRLROVARY211p.H193fsc.577_592delCATCTTATCCGAGTGGFrame_Shift_Del60.3359MN300N
TP53WWCPMSRLRSALIVARY_GLAND216p.E180fsc.539_539delAFrame_Shift_Del60.33A253N300N
TP53WWCPMSRLRLUNG216p.P191fsc.572_572delCFrame_Shift_Del60.33NCIH522N300N
TP53ALSEHCPTTLUNG303p.G279fsc.837_837delGFrame_Shift_Del60.44DMS79N300N
TP53ALSEHCPTTHAEMATOPOIETIC_AND_LYMPHOID_TISSUE303p.P301fsc.902_902delCFrame_Shift_Del60.44KCL22N300N
TP53ALSEHCPTTOESOPHAGUS303p.R267fsc.801_801delGFrame_Shift_Del60.44TE9N300N
TP53ALSEHCPTTHAEMATOPOIETIC_AND_LYMPHOID_TISSUE303p.I251fsc.752_752delTFrame_Shift_Del60.44TF1N300N
TP53APLPSQRRNLUNG313p.G279fsc.837_837delGFrame_Shift_Del40.44DMS79N400N
TP53APLPSQRRNHAEMATOPOIETIC_AND_LYMPHOID_TISSUE313p.P301fsc.902_902delCFrame_Shift_Del40.44KCL22N400N
TP53APLPSQRRNOESOPHAGUS313p.R267fsc.801_801delGFrame_Shift_Del40.44TE9N400N
TP53APLPSQRRNHAEMATOPOIETIC_AND_LYMPHOID_TISSUE313p.I251fsc.752_752delTFrame_Shift_Del40.44TF1N400N
TP53CPTTPAPLPLUNG308p.G279fsc.837_837delGFrame_Shift_Del40.44DMS79N000N
TP53CPTTPAPLPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE308p.P301fsc.902_902delCFrame_Shift_Del40.44KCL22N000N
TP53CPTTPAPLPOESOPHAGUS308p.R267fsc.801_801delGFrame_Shift_Del40.44TE9N000N
TP53CPTTPAPLPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE308p.I251fsc.752_752delTFrame_Shift_Del40.44TF1N000N
TP53DSTPRPAPABREAST148p.P152fsc.455_455delCFrame_Shift_Del40.44HMC18N200N
TP53DSTPRPAPALUNG148p.P152fsc.455_455delCFrame_Shift_Del40.44MORCPRN200N
TP53DSTPRPAPAOVARY148p.P152fsc.455_455delCFrame_Shift_Del40.44OAW28N200N
TP53DSTPRPAPAOVARY148p.P152fsc.455_455delCFrame_Shift_Del40.44OVK18N200N
TP53EHCPTTPAPLUNG306p.G279fsc.837_837delGFrame_Shift_Del50.44DMS79N000N
TP53EHCPTTPAPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE306p.P301fsc.902_902delCFrame_Shift_Del50.44KCL22N000N
TP53EHCPTTPAPOESOPHAGUS306p.R267fsc.801_801delGFrame_Shift_Del50.44TE9N000N
TP53EHCPTTPAPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE306p.I251fsc.752_752delTFrame_Shift_Del50.44TF1N000N
TP53GALSEHCPTLUNG302p.G279fsc.837_837delGFrame_Shift_Del60.44DMS79N200N
TP53GALSEHCPTHAEMATOPOIETIC_AND_LYMPHOID_TISSUE302p.P301fsc.902_902delCFrame_Shift_Del60.44KCL22N200N
TP53GALSEHCPTOESOPHAGUS302p.R267fsc.801_801delGFrame_Shift_Del60.44TE9N200N
TP53GALSEHCPTHAEMATOPOIETIC_AND_LYMPHOID_TISSUE302p.I251fsc.752_752delTFrame_Shift_Del60.44TF1N200N
TP53HCPTTPAPLLUNG307p.G279fsc.837_837delGFrame_Shift_Del50.44DMS79N900N
TP53HCPTTPAPLHAEMATOPOIETIC_AND_LYMPHOID_TISSUE307p.P301fsc.902_902delCFrame_Shift_Del50.44KCL22N900N
TP53HCPTTPAPLOESOPHAGUS307p.R267fsc.801_801delGFrame_Shift_Del50.44TE9N900N
TP53HCPTTPAPLHAEMATOPOIETIC_AND_LYMPHOID_TISSUE307p.I251fsc.752_752delTFrame_Shift_Del50.44TF1N900N
TP53LPSQRRNHWLUNG315p.G279fsc.837_837delGFrame_Shift_Del50.44DMS79Y790N
TP53LPSQRRNHWHAEMATOPOIETIC_AND_LYMPHOID_TISSUE315p.P301fsc.902_902delCFrame_Shift_Del50.44KCL22Y790N
TP53LPSQRRNHWOESOPHAGUS315p.R267fsc.801_801delGFrame_Shift_Del50.44TE9Y790N
TP53LPSQRRNHWHAEMATOPOIETIC_AND_LYMPHOID_TISSUE315p.I251fsc.752_752delTFrame_Shift_Del50.44TF1Y790N
TP53LSEHCPTTPLUNG304p.G279fsc.837_837delGFrame_Shift_Del60.44DMS79N000N
TP53LSEHCPTTPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE304p.P301fsc.902_902delCFrame_Shift_Del60.44KCL22N000N
TP53LSEHCPTTPOESOPHAGUS304p.R267fsc.801_801delGFrame_Shift_Del60.44TE9N000N
TP53LSEHCPTTPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE304p.I251fsc.752_752delTFrame_Shift_Del60.44TF1N000N
TP53LWVDSTPRPBREAST145p.P152fsc.455_455delCFrame_Shift_Del10.44HMC18N004N
TP53LWVDSTPRPLUNG145p.P152fsc.455_455delCFrame_Shift_Del10.44MORCPRN004N
TP53LWVDSTPRPOVARY145p.P152fsc.455_455delCFrame_Shift_Del10.44OAW28N004N
TP53LWVDSTPRPOVARY145p.P152fsc.455_455delCFrame_Shift_Del10.44OVK18N004N
TP53PAPLPSQRRLUNG312p.G279fsc.837_837delGFrame_Shift_Del40.44DMS79N000N
TP53PAPLPSQRRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE312p.P301fsc.902_902delCFrame_Shift_Del40.44KCL22N000N
TP53PAPLPSQRROESOPHAGUS312p.R267fsc.801_801delGFrame_Shift_Del40.44TE9N000N
TP53PAPLPSQRRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE312p.I251fsc.752_752delTFrame_Shift_Del40.44TF1N000N
TP53PLPSQRRNHLUNG314p.G279fsc.837_837delGFrame_Shift_Del40.44DMS79N000Y
TP53PLPSQRRNHHAEMATOPOIETIC_AND_LYMPHOID_TISSUE314p.P301fsc.902_902delCFrame_Shift_Del40.44KCL22N000Y
TP53PLPSQRRNHOESOPHAGUS314p.R267fsc.801_801delGFrame_Shift_Del40.44TE9N000Y
TP53PLPSQRRNHHAEMATOPOIETIC_AND_LYMPHOID_TISSUE314p.I251fsc.752_752delTFrame_Shift_Del40.44TF1N000Y
TP53PQGALSEHCLUNG300p.G279fsc.837_837delGFrame_Shift_Del60.44DMS79N000N
TP53PQGALSEHCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE300p.P301fsc.902_902delCFrame_Shift_Del60.44KCL22N000N
TP53PQGALSEHCOESOPHAGUS300p.R267fsc.801_801delGFrame_Shift_Del60.44TE9N000N
TP53PQGALSEHCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE300p.I251fsc.752_752delTFrame_Shift_Del60.44TF1N000N
TP53PSQRRNHWMLUNG316p.G279fsc.837_837delGFrame_Shift_Del50.44DMS79N000N
TP53PSQRRNHWMHAEMATOPOIETIC_AND_LYMPHOID_TISSUE316p.P301fsc.902_902delCFrame_Shift_Del50.44KCL22N000N
TP53PSQRRNHWMOESOPHAGUS316p.R267fsc.801_801delGFrame_Shift_Del50.44TE9N000N
TP53PSQRRNHWMHAEMATOPOIETIC_AND_LYMPHOID_TISSUE316p.I251fsc.752_752delTFrame_Shift_Del50.44TF1N000N
TP53PTTPAPLPSLUNG309p.G279fsc.837_837delGFrame_Shift_Del30.44DMS79N000N
TP53PTTPAPLPSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE309p.P301fsc.902_902delCFrame_Shift_Del30.44KCL22N000N
TP53PTTPAPLPSOESOPHAGUS309p.R267fsc.801_801delGFrame_Shift_Del30.44TE9N000N
TP53PTTPAPLPSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE309p.I251fsc.752_752delTFrame_Shift_Del30.44TF1N000N
TP53QGALSEHCPLUNG301p.G279fsc.837_837delGFrame_Shift_Del60.44DMS79N000N
TP53QGALSEHCPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE301p.P301fsc.902_902delCFrame_Shift_Del60.44KCL22N000N
TP53QGALSEHCPOESOPHAGUS301p.R267fsc.801_801delGFrame_Shift_Del60.44TE9N000N
TP53QGALSEHCPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE301p.I251fsc.752_752delTFrame_Shift_Del60.44TF1N000N
TP53QLWVDSTPRBREAST144p.P152fsc.455_455delCFrame_Shift_Del10.44HMC18N700N
TP53QLWVDSTPRLUNG144p.P152fsc.455_455delCFrame_Shift_Del10.44MORCPRN700N
TP53QLWVDSTPROVARY144p.P152fsc.455_455delCFrame_Shift_Del10.44OAW28N700N
TP53QLWVDSTPROVARY144p.P152fsc.455_455delCFrame_Shift_Del10.44OVK18N700N
TP53QRRNHWMENLUNG318p.G279fsc.837_837delGFrame_Shift_Del60.44DMS79N200N
TP53QRRNHWMENHAEMATOPOIETIC_AND_LYMPHOID_TISSUE318p.P301fsc.902_902delCFrame_Shift_Del60.44KCL22N200N
TP53QRRNHWMENOESOPHAGUS318p.R267fsc.801_801delGFrame_Shift_Del60.44TE9N200N
TP53QRRNHWMENHAEMATOPOIETIC_AND_LYMPHOID_TISSUE318p.I251fsc.752_752delTFrame_Shift_Del60.44TF1N200N
TP53RNHWMENISLUNG320p.G279fsc.837_837delGFrame_Shift_Del60.44DMS79N000N
TP53RNHWMENISHAEMATOPOIETIC_AND_LYMPHOID_TISSUE320p.P301fsc.902_902delCFrame_Shift_Del60.44KCL22N000N
TP53RNHWMENISOESOPHAGUS320p.R267fsc.801_801delGFrame_Shift_Del60.44TE9N000N
TP53RNHWMENISHAEMATOPOIETIC_AND_LYMPHOID_TISSUE320p.I251fsc.752_752delTFrame_Shift_Del60.44TF1N000N
TP53RRNHWMENILUNG319p.G279fsc.837_837delGFrame_Shift_Del60.44DMS79Y5110N
TP53RRNHWMENIHAEMATOPOIETIC_AND_LYMPHOID_TISSUE319p.P301fsc.902_902delCFrame_Shift_Del60.44KCL22Y5110N
TP53RRNHWMENIOESOPHAGUS319p.R267fsc.801_801delGFrame_Shift_Del60.44TE9Y5110N
TP53RRNHWMENIHAEMATOPOIETIC_AND_LYMPHOID_TISSUE319p.I251fsc.752_752delTFrame_Shift_Del60.44TF1Y5110N
TP53SEHCPTTPALUNG305p.G279fsc.837_837delGFrame_Shift_Del50.44DMS79N600N
TP53SEHCPTTPAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE305p.P301fsc.902_902delCFrame_Shift_Del50.44KCL22N600N
TP53SEHCPTTPAOESOPHAGUS305p.R267fsc.801_801delGFrame_Shift_Del50.44TE9N600N
TP53SEHCPTTPAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE305p.I251fsc.752_752delTFrame_Shift_Del50.44TF1N600N
TP53SQRRNHWMELUNG317p.G279fsc.837_837delGFrame_Shift_Del60.44DMS79N000N
TP53SQRRNHWMEHAEMATOPOIETIC_AND_LYMPHOID_TISSUE317p.P301fsc.902_902delCFrame_Shift_Del60.44KCL22N000N
TP53SQRRNHWMEOESOPHAGUS317p.R267fsc.801_801delGFrame_Shift_Del60.44TE9N000N
TP53SQRRNHWMEHAEMATOPOIETIC_AND_LYMPHOID_TISSUE317p.I251fsc.752_752delTFrame_Shift_Del60.44TF1N000N
TP53STPRPAPASBREAST149p.P152fsc.455_455delCFrame_Shift_Del50.44HMC18N100N
TP53STPRPAPASLUNG149p.P152fsc.455_455delCFrame_Shift_Del50.44MORCPRN100N
TP53STPRPAPASOVARY149p.P152fsc.455_455delCFrame_Shift_Del50.44OAW28N100N
TP53STPRPAPASOVARY149p.P152fsc.455_455delCFrame_Shift_Del50.44OVK18N100N
TP53TPAPLPSQRLUNG311p.G279fsc.837_837delGFrame_Shift_Del40.44DMS79Y3100N
TP53TPAPLPSQRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE311p.P301fsc.902_902delCFrame_Shift_Del40.44KCL22Y3100N
TP53TPAPLPSQROESOPHAGUS311p.R267fsc.801_801delGFrame_Shift_Del40.44TE9Y3100N
TP53TPAPLPSQRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE311p.I251fsc.752_752delTFrame_Shift_Del40.44TF1Y3100N
TP53TPRPAPASABREAST150p.P152fsc.455_455delCFrame_Shift_Del40.44HMC18Y9120N
TP53TPRPAPASALUNG150p.P152fsc.455_455delCFrame_Shift_Del40.44MORCPRY9120N
TP53TPRPAPASAOVARY150p.P152fsc.455_455delCFrame_Shift_Del40.44OAW28Y9120N
TP53TPRPAPASAOVARY150p.P152fsc.455_455delCFrame_Shift_Del40.44OVK18Y9120N
TP53TTPAPLPSQLUNG310p.G279fsc.837_837delGFrame_Shift_Del40.44DMS79N000N
TP53TTPAPLPSQHAEMATOPOIETIC_AND_LYMPHOID_TISSUE310p.P301fsc.902_902delCFrame_Shift_Del40.44KCL22N000N
TP53TTPAPLPSQOESOPHAGUS310p.R267fsc.801_801delGFrame_Shift_Del40.44TE9N000N
TP53TTPAPLPSQHAEMATOPOIETIC_AND_LYMPHOID_TISSUE310p.I251fsc.752_752delTFrame_Shift_Del40.44TF1N000N
TP53VDSTPRPAPBREAST147p.P152fsc.455_455delCFrame_Shift_Del30.44HMC18N000N
TP53VDSTPRPAPLUNG147p.P152fsc.455_455delCFrame_Shift_Del30.44MORCPRN000N
TP53VDSTPRPAPOVARY147p.P152fsc.455_455delCFrame_Shift_Del30.44OAW28N000N
TP53VDSTPRPAPOVARY147p.P152fsc.455_455delCFrame_Shift_Del30.44OVK18N000N
TP53WVDSTPRPABREAST146p.P152fsc.455_455delCFrame_Shift_Del20.44HMC18Y4102N
TP53WVDSTPRPALUNG146p.P152fsc.455_455delCFrame_Shift_Del20.44MORCPRY4102N
TP53WVDSTPRPAOVARY146p.P152fsc.455_455delCFrame_Shift_Del20.44OAW28Y4102N
TP53WVDSTPRPAOVARY146p.P152fsc.455_455delCFrame_Shift_Del20.44OVK18Y4102N
TP53ENISPFRSVLUNG325p.G279fsc.837_837delGFrame_Shift_Del60.55DMS79Y1140N
TP53ENISPFRSVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE325p.P301fsc.902_902delCFrame_Shift_Del60.55KCL22Y1140N
TP53ENISPFRSVOESOPHAGUS325p.R267fsc.801_801delGFrame_Shift_Del60.55TE9Y1140N
TP53ENISPFRSVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE325p.I251fsc.752_752delTFrame_Shift_Del60.55TF1Y1140N
TP53FRSVGVSASLUNG330p.G279fsc.837_837delGFrame_Shift_Del60.55DMS79N4038N
TP53FRSVGVSASHAEMATOPOIETIC_AND_LYMPHOID_TISSUE330p.P301fsc.902_902delCFrame_Shift_Del60.55KCL22N4038N
TP53FRSVGVSASOESOPHAGUS330p.R267fsc.801_801delGFrame_Shift_Del60.55TE9N4038N
TP53FRSVGVSASHAEMATOPOIETIC_AND_LYMPHOID_TISSUE330p.I251fsc.752_752delTFrame_Shift_Del60.55TF1N4038N
TP53GVSASRCSELUNG334p.G279fsc.837_837delGFrame_Shift_Del50.55DMS79N000N
TP53GVSASRCSEHAEMATOPOIETIC_AND_LYMPHOID_TISSUE334p.P301fsc.902_902delCFrame_Shift_Del50.55KCL22N000N
TP53GVSASRCSEOESOPHAGUS334p.R267fsc.801_801delGFrame_Shift_Del50.55TE9N000N
TP53GVSASRCSEHAEMATOPOIETIC_AND_LYMPHOID_TISSUE334p.I251fsc.752_752delTFrame_Shift_Del50.55TF1N000N
TP53HWMENISPFLUNG322p.G279fsc.837_837delGFrame_Shift_Del60.55DMS79N400N
TP53HWMENISPFHAEMATOPOIETIC_AND_LYMPHOID_TISSUE322p.P301fsc.902_902delCFrame_Shift_Del60.55KCL22N400N
TP53HWMENISPFOESOPHAGUS322p.R267fsc.801_801delGFrame_Shift_Del60.55TE9N400N
TP53HWMENISPFHAEMATOPOIETIC_AND_LYMPHOID_TISSUE322p.I251fsc.752_752delTFrame_Shift_Del60.55TF1N400N
TP53ISPFRSVGVLUNG327p.G279fsc.837_837delGFrame_Shift_Del60.55DMS79Y6112N
TP53ISPFRSVGVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE327p.P301fsc.902_902delCFrame_Shift_Del60.55KCL22Y6112N
TP53ISPFRSVGVOESOPHAGUS327p.R267fsc.801_801delGFrame_Shift_Del60.55TE9Y6112N
TP53ISPFRSVGVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE327p.I251fsc.752_752delTFrame_Shift_Del60.55TF1Y6112N
TP53MENISPFRSLUNG324p.G279fsc.837_837delGFrame_Shift_Del60.55DMS79N3018N
TP53MENISPFRSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE324p.P301fsc.902_902delCFrame_Shift_Del60.55KCL22N3018N
TP53MENISPFRSOESOPHAGUS324p.R267fsc.801_801delGFrame_Shift_Del60.55TE9N3018N
TP53MENISPFRSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE324p.I251fsc.752_752delTFrame_Shift_Del60.55TF1N3018N
TP53NHWMENISPLUNG321p.G279fsc.837_837delGFrame_Shift_Del60.55DMS79N000N
TP53NHWMENISPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE321p.P301fsc.902_902delCFrame_Shift_Del60.55KCL22N000N
TP53NHWMENISPOESOPHAGUS321p.R267fsc.801_801delGFrame_Shift_Del60.55TE9N000N
TP53NHWMENISPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE321p.I251fsc.752_752delTFrame_Shift_Del60.55TF1N000N
TP53NISPFRSVGLUNG326p.G279fsc.837_837delGFrame_Shift_Del60.55DMS79N000N
TP53NISPFRSVGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE326p.P301fsc.902_902delCFrame_Shift_Del60.55KCL22N000N
TP53NISPFRSVGOESOPHAGUS326p.R267fsc.801_801delGFrame_Shift_Del60.55TE9N000N
TP53NISPFRSVGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE326p.I251fsc.752_752delTFrame_Shift_Del60.55TF1N000N
TP53PFRSVGVSALUNG329p.G279fsc.837_837delGFrame_Shift_Del60.55DMS79N000N
TP53PFRSVGVSAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE329p.P301fsc.902_902delCFrame_Shift_Del60.55KCL22N000N
TP53PFRSVGVSAOESOPHAGUS329p.R267fsc.801_801delGFrame_Shift_Del60.55TE9N000N
TP53PFRSVGVSAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE329p.I251fsc.752_752delTFrame_Shift_Del60.55TF1N000N
TP53RSVGVSASRLUNG331p.G279fsc.837_837delGFrame_Shift_Del50.55DMS79N400N
TP53RSVGVSASRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE331p.P301fsc.902_902delCFrame_Shift_Del50.55KCL22N400N
TP53RSVGVSASROESOPHAGUS331p.R267fsc.801_801delGFrame_Shift_Del50.55TE9N400N
TP53RSVGVSASRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE331p.I251fsc.752_752delTFrame_Shift_Del50.55TF1N400N
TP53SPFRSVGVSLUNG328p.G279fsc.837_837delGFrame_Shift_Del60.55DMS79N400N
TP53SPFRSVGVSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE328p.P301fsc.902_902delCFrame_Shift_Del60.55KCL22N400N
TP53SPFRSVGVSOESOPHAGUS328p.R267fsc.801_801delGFrame_Shift_Del60.55TE9N400N
TP53SPFRSVGVSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE328p.I251fsc.752_752delTFrame_Shift_Del60.55TF1N400N
TP53SVGVSASRCLUNG332p.G279fsc.837_837delGFrame_Shift_Del50.55DMS79N000N
TP53SVGVSASRCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE332p.P301fsc.902_902delCFrame_Shift_Del50.55KCL22N000N
TP53SVGVSASRCOESOPHAGUS332p.R267fsc.801_801delGFrame_Shift_Del50.55TE9N000N
TP53SVGVSASRCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE332p.I251fsc.752_752delTFrame_Shift_Del50.55TF1N000N
TP53VGVSASRCSLUNG333p.G279fsc.837_837delGFrame_Shift_Del50.55DMS79N007N
TP53VGVSASRCSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE333p.P301fsc.902_902delCFrame_Shift_Del50.55KCL22N007N
TP53VGVSASRCSOESOPHAGUS333p.R267fsc.801_801delGFrame_Shift_Del50.55TE9N007N
TP53VGVSASRCSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE333p.I251fsc.752_752delTFrame_Shift_Del50.55TF1N007N
TP53VSASRCSESLUNG335p.G279fsc.837_837delGFrame_Shift_Del50.55DMS79N000N
TP53VSASRCSESHAEMATOPOIETIC_AND_LYMPHOID_TISSUE335p.P301fsc.902_902delCFrame_Shift_Del50.55KCL22N000N
TP53VSASRCSESOESOPHAGUS335p.R267fsc.801_801delGFrame_Shift_Del50.55TE9N000N
TP53VSASRCSESHAEMATOPOIETIC_AND_LYMPHOID_TISSUE335p.I251fsc.752_752delTFrame_Shift_Del50.55TF1N000N
TP53WMENISPFRLUNG323p.G279fsc.837_837delGFrame_Shift_Del60.55DMS79N1000N
TP53WMENISPFRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE323p.P301fsc.902_902delCFrame_Shift_Del60.55KCL22N1000N
TP53WMENISPFROESOPHAGUS323p.R267fsc.801_801delGFrame_Shift_Del60.55TE9N1000N
TP53WMENISPFRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE323p.I251fsc.752_752delTFrame_Shift_Del60.55TF1N1000N
TP53APASAPWPSPANCREAS154p.C135fsc.403_403delTFrame_Shift_Del40.77ASPC1N300N
TP53APASAPWPSLUNG154p.K139fsc.417_417delGFrame_Shift_Del40.77HCC1438N300N
TP53APASAPWPSBREAST154p.P152fsc.455_455delCFrame_Shift_Del40.77HMC18N300N
TP53APASAPWPSLUNG154p.P152fsc.455_455delCFrame_Shift_Del40.77MORCPRN300N
TP53APASAPWPSOVARY154p.P152fsc.455_455delCFrame_Shift_Del40.77OAW28N300N
TP53APASAPWPSOVARY154p.P152fsc.455_455delCFrame_Shift_Del40.77OVK18N300N
TP53APASAPWPSPROSTATE154p.A138fsc.414_414delCFrame_Shift_Del40.77PC3N300N
TP53PAPASAPWPPANCREAS153p.C135fsc.403_403delTFrame_Shift_Del40.77ASPC1N000N
TP53PAPASAPWPLUNG153p.K139fsc.417_417delGFrame_Shift_Del40.77HCC1438N000N
TP53PAPASAPWPBREAST153p.P152fsc.455_455delCFrame_Shift_Del40.77HMC18N000N
TP53PAPASAPWPLUNG153p.P152fsc.455_455delCFrame_Shift_Del40.77MORCPRN000N
TP53PAPASAPWPOVARY153p.P152fsc.455_455delCFrame_Shift_Del40.77OAW28N000N
TP53PAPASAPWPOVARY153p.P152fsc.455_455delCFrame_Shift_Del40.77OVK18N000N
TP53PAPASAPWPPROSTATE153p.A138fsc.414_414delCFrame_Shift_Del40.77PC3N000N
TP53PRPAPASAPPANCREAS151p.C135fsc.403_403delTFrame_Shift_Del40.77ASPC1N000N
TP53PRPAPASAPLUNG151p.K139fsc.417_417delGFrame_Shift_Del40.77HCC1438N000N
TP53PRPAPASAPBREAST151p.P152fsc.455_455delCFrame_Shift_Del40.77HMC18N000N
TP53PRPAPASAPLUNG151p.P152fsc.455_455delCFrame_Shift_Del40.77MORCPRN000N
TP53PRPAPASAPOVARY151p.P152fsc.455_455delCFrame_Shift_Del40.77OAW28N000N
TP53PRPAPASAPOVARY151p.P152fsc.455_455delCFrame_Shift_Del40.77OVK18N000N
TP53PRPAPASAPPROSTATE151p.A138fsc.414_414delCFrame_Shift_Del40.77PC3N000N
TP53RPAPASAPWPANCREAS152p.C135fsc.403_403delTFrame_Shift_Del40.77ASPC1Y10120N
TP53RPAPASAPWLUNG152p.K139fsc.417_417delGFrame_Shift_Del40.77HCC1438Y10120N
TP53RPAPASAPWBREAST152p.P152fsc.455_455delCFrame_Shift_Del40.77HMC18Y10120N
TP53RPAPASAPWLUNG152p.P152fsc.455_455delCFrame_Shift_Del40.77MORCPRY10120N
TP53RPAPASAPWOVARY152p.P152fsc.455_455delCFrame_Shift_Del40.77OAW28Y10120N
TP53RPAPASAPWOVARY152p.P152fsc.455_455delCFrame_Shift_Del40.77OVK18Y10120N
TP53RPAPASAPWPROSTATE152p.A138fsc.414_414delCFrame_Shift_Del40.77PC3Y10120N
TP53APWPSTSSHPANCREAS158p.C135fsc.403_403delTFrame_Shift_Del50.88ASPC1N100N
TP53APWPSTSSHLUNG158p.K139fsc.417_417delGFrame_Shift_Del50.88HCC1438N100N
TP53APWPSTSSHBREAST158p.P152fsc.455_455delCFrame_Shift_Del50.88HMC18N100N
TP53APWPSTSSHLUNG158p.P152fsc.455_455delCFrame_Shift_Del50.88MORCPRN100N
TP53APWPSTSSHOVARY158p.P152fsc.455_455delCFrame_Shift_Del50.88OAW28N100N
TP53APWPSTSSHOVARY158p.P152fsc.455_455delCFrame_Shift_Del50.88OVK18N100N
TP53APWPSTSSHPROSTATE158p.A138fsc.414_414delCFrame_Shift_Del50.88PC3N100N
TP53APWPSTSSHSOFT_TISSUE154p.P152fsc.454_466delCCGCCCGGCACCCFrame_Shift_Del50.88RH41N100N
TP53ASAPWPSTSPANCREAS156p.C135fsc.403_403delTFrame_Shift_Del40.88ASPC1Y1110N
TP53ASAPWPSTSLUNG156p.K139fsc.417_417delGFrame_Shift_Del40.88HCC1438Y1110N
TP53ASAPWPSTSBREAST156p.P152fsc.455_455delCFrame_Shift_Del40.88HMC18Y1110N
TP53ASAPWPSTSLUNG156p.P152fsc.455_455delCFrame_Shift_Del40.88MORCPRY1110N
TP53ASAPWPSTSOVARY156p.P152fsc.455_455delCFrame_Shift_Del40.88OAW28Y1110N
TP53ASAPWPSTSOVARY156p.P152fsc.455_455delCFrame_Shift_Del40.88OVK18Y1110N
TP53ASAPWPSTSPROSTATE156p.A138fsc.414_414delCFrame_Shift_Del40.88PC3Y1110N
TP53ASAPWPSTSSOFT_TISSUE152p.P152fsc.454_466delCCGCCCGGCACCCFrame_Shift_Del40.88RH41Y1110N
TP53PASAPWPSTPANCREAS155p.C135fsc.403_403delTFrame_Shift_Del40.88ASPC1N000N
TP53PASAPWPSTLUNG155p.K139fsc.417_417delGFrame_Shift_Del40.88HCC1438N000N
TP53PASAPWPSTBREAST155p.P152fsc.455_455delCFrame_Shift_Del40.88HMC18N000N
TP53PASAPWPSTLUNG155p.P152fsc.455_455delCFrame_Shift_Del40.88MORCPRN000N
TP53PASAPWPSTOVARY155p.P152fsc.455_455delCFrame_Shift_Del40.88OAW28N000N
TP53PASAPWPSTOVARY155p.P152fsc.455_455delCFrame_Shift_Del40.88OVK18N000N
TP53PASAPWPSTPROSTATE155p.A138fsc.414_414delCFrame_Shift_Del40.88PC3N000N
TP53PASAPWPSTSOFT_TISSUE151p.P152fsc.454_466delCCGCCCGGCACCCFrame_Shift_Del40.88RH41N000N
TP53PWPSTSSHSPANCREAS159p.C135fsc.403_403delTFrame_Shift_Del50.88ASPC1N000N
TP53PWPSTSSHSLUNG159p.K139fsc.417_417delGFrame_Shift_Del50.88HCC1438N000N
TP53PWPSTSSHSBREAST159p.P152fsc.455_455delCFrame_Shift_Del50.88HMC18N000N
TP53PWPSTSSHSLUNG159p.P152fsc.455_455delCFrame_Shift_Del50.88MORCPRN000N
TP53PWPSTSSHSOVARY159p.P152fsc.455_455delCFrame_Shift_Del50.88OAW28N000N
TP53PWPSTSSHSOVARY159p.P152fsc.455_455delCFrame_Shift_Del50.88OVK18N000N
TP53PWPSTSSHSPROSTATE159p.A138fsc.414_414delCFrame_Shift_Del50.88PC3N000N
TP53PWPSTSSHSSOFT_TISSUE155p.P152fsc.454_466delCCGCCCGGCACCCFrame_Shift_Del50.88RH41N000N
TP53SAPWPSTSSPANCREAS157p.C135fsc.403_403delTFrame_Shift_Del50.88ASPC1N200N
TP53SAPWPSTSSLUNG157p.K139fsc.417_417delGFrame_Shift_Del50.88HCC1438N200N
TP53SAPWPSTSSBREAST157p.P152fsc.455_455delCFrame_Shift_Del50.88HMC18N200N
TP53SAPWPSTSSLUNG157p.P152fsc.455_455delCFrame_Shift_Del50.88MORCPRN200N
TP53SAPWPSTSSOVARY157p.P152fsc.455_455delCFrame_Shift_Del50.88OAW28N200N
TP53SAPWPSTSSOVARY157p.P152fsc.455_455delCFrame_Shift_Del50.88OVK18N200N
TP53SAPWPSTSSPROSTATE157p.A138fsc.414_414delCFrame_Shift_Del50.88PC3N200N
TP53SAPWPSTSSSOFT_TISSUE153p.P152fsc.454_466delCCGCCCGGCACCCFrame_Shift_Del50.88RH41N200N
TP53WPSTSSHSTPANCREAS160p.C135fsc.403_403delTFrame_Shift_Del50.88ASPC1N700N
TP53WPSTSSHSTLUNG160p.K139fsc.417_417delGFrame_Shift_Del50.88HCC1438N700N
TP53WPSTSSHSTBREAST160p.P152fsc.455_455delCFrame_Shift_Del50.88HMC18N700N
TP53WPSTSSHSTLUNG160p.P152fsc.455_455delCFrame_Shift_Del50.88MORCPRN700N
TP53WPSTSSHSTOVARY160p.P152fsc.455_455delCFrame_Shift_Del50.88OAW28N700N
TP53WPSTSSHSTOVARY160p.P152fsc.455_455delCFrame_Shift_Del50.88OVK18N700N
TP53WPSTSSHSTPROSTATE160p.A138fsc.414_414delCFrame_Shift_Del50.88PC3N700N
TP53WPSTSSHSTSOFT_TISSUE156p.P152fsc.454_466delCCGCCCGGCACCCFrame_Shift_Del50.88RH41N700N
TP53ALNKMFCPTHAEMATOPOIETIC_AND_LYMPHOID_TISSUE129p.Q136fsc.406_407insCFrame_Shift_Ins20.11K562N300N
TP53ALPKQHQLLOESOPHAGUS307p.N310fsc.929_930insAFrame_Shift_Ins50.11OE19Y14110N
TP53CPTGQDLPCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE135p.Q136fsc.406_407insCFrame_Shift_Ins60.11K562N400N
TP53DSSGNLLGSBILIARY_TRACT259p.G266fsc.798_799insTFrame_Shift_Ins10.11SNU478N100N
TP53FCPTGQDLPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE134p.Q136fsc.406_407insCFrame_Shift_Ins60.11K562N200N
TP53GGMNRRPNPOESOPHAGUS244p.I251fsc.751_752insAFrame_Shift_Ins20.11KYSE70N000Y
TP53GMNRRPNPHOESOPHAGUS245p.I251fsc.751_752insAFrame_Shift_Ins30.11KYSE70N100N
TP53GNLLGSEQLBILIARY_TRACT262p.G266fsc.798_799insTFrame_Shift_Ins40.11SNU478N900N
TP53GSTKRALPKOESOPHAGUS302p.N310fsc.929_930insAFrame_Shift_Ins10.11OE19N200Y
TP53HQLLSPAKEOESOPHAGUS312p.N310fsc.929_930insAFrame_Shift_Ins60.11OE19N000N
TP53KKKNHWMENSKIN319p.K321fsc.963_964insAAFrame_Shift_Ins50.11COLO741N200N
TP53KKNHWMENISKIN320p.K321fsc.963_964insAAFrame_Shift_Ins60.11COLO741Y4120N
TP53KMFCPTGQDHAEMATOPOIETIC_AND_LYMPHOID_TISSUE132p.Q136fsc.406_407insCFrame_Shift_Ins50.11K562N100N
TP53KNHWMENISSKIN321p.K321fsc.963_964insAAFrame_Shift_Ins60.11COLO741N000N
TP53KQHQLLSPAOESOPHAGUS310p.N310fsc.929_930insAFrame_Shift_Ins60.11OE19N700N
TP53KRALPKQHQOESOPHAGUS305p.N310fsc.929_930insAFrame_Shift_Ins40.11OE19N200N
TP53LLSPAKEETOESOPHAGUS314p.N310fsc.929_930insAFrame_Shift_Ins50.11OE19N100N
TP53LNKMFCPTGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE130p.Q136fsc.406_407insCFrame_Shift_Ins30.11K562N001N
TP53LPKQHQLLSOESOPHAGUS308p.N310fsc.929_930insAFrame_Shift_Ins60.11OE19N600N
TP53LSPAKEETTOESOPHAGUS315p.N310fsc.929_930insAFrame_Shift_Ins50.11OE19N200N
TP53MFCPTGQDLHAEMATOPOIETIC_AND_LYMPHOID_TISSUE133p.Q136fsc.406_407insCFrame_Shift_Ins50.11K562Y7110N
TP53MNRRPNPHHOESOPHAGUS246p.I251fsc.751_752insAFrame_Shift_Ins40.11KYSE70N006N
TP53NKMFCPTGQHAEMATOPOIETIC_AND_LYMPHOID_TISSUE131p.Q136fsc.406_407insCFrame_Shift_Ins40.11K562N000N
TP53NNTSSSPPAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE310p.Q317fsc.949_950insCFrame_Shift_Ins20.11MEC1N000N
TP53NPHHHHTGROESOPHAGUS251p.I251fsc.751_752insAFrame_Shift_Ins60.11KYSE70N400N
TP53NRRPNPHHHOESOPHAGUS247p.I251fsc.751_752insAFrame_Shift_Ins50.11KYSE70Y290N
TP53NTSSSPPAKHAEMATOPOIETIC_AND_LYMPHOID_TISSUE311p.Q317fsc.949_950insCFrame_Shift_Ins20.11MEC1N100N
TP53PALNKMFCPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE128p.Q136fsc.406_407insCFrame_Shift_Ins10.11K562N000N
TP53PKKKNHWMESKIN318p.K321fsc.963_964insAAFrame_Shift_Ins40.11COLO741N000N
TP53PKQHQLLSPOESOPHAGUS309p.N310fsc.929_930insAFrame_Shift_Ins60.11OE19N000N
TP53PNNTSSSPPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE309p.Q317fsc.949_950insCFrame_Shift_Ins10.11MEC1N000N
TP53PNPHHHHTGOESOPHAGUS250p.I251fsc.751_752insAFrame_Shift_Ins60.11KYSE70N000N
TP53PPAKEETTGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE316p.Q317fsc.949_950insCFrame_Shift_Ins50.11MEC1N000N
TP53PQPKKKNHWSKIN316p.K321fsc.963_964insAAFrame_Shift_Ins30.11COLO741N000N
TP53QHQLLSPAKOESOPHAGUS311p.N310fsc.929_930insAFrame_Shift_Ins60.11OE19N000N
TP53QLLSPAKEEOESOPHAGUS313p.N310fsc.929_930insAFrame_Shift_Ins50.11OE19N000N
TP53QPKKKNHWMSKIN317p.K321fsc.963_964insAAFrame_Shift_Ins40.11COLO741Y12100N
TP53RALPKQHQLOESOPHAGUS306p.N310fsc.929_930insAFrame_Shift_Ins50.11OE19Y18100N
TP53RPNPHHHHTOESOPHAGUS249p.I251fsc.751_752insAFrame_Shift_Ins50.11KYSE70N400N
TP53RRPNPHHHHOESOPHAGUS248p.I251fsc.751_752insAFrame_Shift_Ins50.11KYSE70N200N
TP53SGNLLGSEQBILIARY_TRACT261p.G266fsc.798_799insTFrame_Shift_Ins30.11SNU478N000N
TP53SPAKEETTGOESOPHAGUS316p.N310fsc.929_930insAFrame_Shift_Ins60.11OE19N000N
TP53SPPAKEETTHAEMATOPOIETIC_AND_LYMPHOID_TISSUE315p.Q317fsc.949_950insCFrame_Shift_Ins50.11MEC1N600N
TP53SPQPKKKNHSKIN315p.K321fsc.963_964insAAFrame_Shift_Ins20.11COLO741N000N
TP53SSGNLLGSEBILIARY_TRACT260p.G266fsc.798_799insTFrame_Shift_Ins20.11SNU478N000N
TP53SSPPAKEETHAEMATOPOIETIC_AND_LYMPHOID_TISSUE314p.Q317fsc.949_950insCFrame_Shift_Ins50.11MEC1N200N
TP53SSPQPKKKNSKIN314p.K321fsc.963_964insAAFrame_Shift_Ins10.11COLO741N000N
TP53SSSPPAKEEHAEMATOPOIETIC_AND_LYMPHOID_TISSUE313p.Q317fsc.949_950insCFrame_Shift_Ins40.11MEC1N000N
TP53STKRALPKQOESOPHAGUS303p.N310fsc.929_930insAFrame_Shift_Ins20.11OE19N000Y
TP53TKRALPKQHOESOPHAGUS304p.N310fsc.929_930insAFrame_Shift_Ins30.11OE19N100N
TP53TSSSPPAKEHAEMATOPOIETIC_AND_LYMPHOID_TISSUE312p.Q317fsc.949_950insCFrame_Shift_Ins30.11MEC1N000N
TP53AHDGGCEALSTOMACH168p.P152fsc.455_456insCFrame_Shift_Ins60.22HGC27Y3100N
TP53AHDGGCEALPANCREAS168p.P152fsc.455_456insCFrame_Shift_Ins60.22KP3Y3100N
TP53AKEETTGWRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE318p.Q317fsc.949_950insCFrame_Shift_Ins50.22MEC1N100N
TP53AKEETTGWROESOPHAGUS318p.N310fsc.929_930insAFrame_Shift_Ins50.22OE19N100N
TP53ARHPRPRHGSTOMACH153p.P152fsc.455_456insCFrame_Shift_Ins60.22HGC27Y090N
TP53ARHPRPRHGPANCREAS153p.P152fsc.455_456insCFrame_Shift_Ins60.22KP3Y090N
TP53AVTAHDGGCSTOMACH165p.P152fsc.455_456insCFrame_Shift_Ins60.22HGC27N000N
TP53AVTAHDGGCPANCREAS165p.P152fsc.455_456insCFrame_Shift_Ins60.22KP3N000N
TP53DGGCEALPPSTOMACH170p.P152fsc.455_456insCFrame_Shift_Ins50.22HGC27N000N
TP53DGGCEALPPPANCREAS170p.P152fsc.455_456insCFrame_Shift_Ins50.22KP3N000N
TP53DSTPPARHPSTOMACH148p.P152fsc.455_456insCFrame_Shift_Ins40.22HGC27N000N
TP53DSTPPARHPPANCREAS148p.P152fsc.455_456insCFrame_Shift_Ins40.22KP3N000N
TP53EETTGWRIFHAEMATOPOIETIC_AND_LYMPHOID_TISSUE320p.Q317fsc.949_950insCFrame_Shift_Ins60.22MEC1Y790N
TP53EETTGWRIFOESOPHAGUS320p.N310fsc.929_930insAFrame_Shift_Ins60.22OE19Y790N
TP53ENNVLSPFALUNG28p.L35fsc.104_105insTFrame_Shift_Ins20.22NCIH1339N000N
TP53ENNVLSPFALUNG28p.L35fsc.104_105insTFrame_Shift_Ins20.22NCIH1648N000N
TP53ETTGWRIFHHAEMATOPOIETIC_AND_LYMPHOID_TISSUE321p.Q317fsc.949_950insCFrame_Shift_Ins60.22MEC1N000N
TP53ETTGWRIFHOESOPHAGUS321p.N310fsc.929_930insAFrame_Shift_Ins60.22OE19N000N
TP53GGCEALPPPSTOMACH171p.P152fsc.455_456insCFrame_Shift_Ins50.22HGC27N000N
TP53GGCEALPPPPANCREAS171p.P152fsc.455_456insCFrame_Shift_Ins50.22KP3N000N
TP53GHLQAVTAHSTOMACH161p.P152fsc.455_456insCFrame_Shift_Ins50.22HGC27N000N
TP53GHLQAVTAHPANCREAS161p.P152fsc.455_456insCFrame_Shift_Ins50.22KP3N000N
TP53GQDLPCAAVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE138p.Q136fsc.406_407insCFrame_Shift_Ins60.22K562Y4100N
TP53HDGGCEALPSTOMACH169p.P152fsc.455_456insCFrame_Shift_Ins60.22HGC27N100N
TP53HDGGCEALPPANCREAS169p.P152fsc.455_456insCFrame_Shift_Ins60.22KP3N100N
TP53HGHLQAVTASTOMACH160p.P152fsc.455_456insCFrame_Shift_Ins50.22HGC27N300N
TP53HGHLQAVTAPANCREAS160p.P152fsc.455_456insCFrame_Shift_Ins50.22KP3N300N
TP53HHHHTGRLQOESOPHAGUS253p.I251fsc.751_752insAFrame_Shift_Ins70.22KYSE70N000N
TP53HHHTGRLQWOESOPHAGUS254p.I251fsc.751_752insAFrame_Shift_Ins70.22KYSE70N300N
TP53HLQAVTAHDSTOMACH162p.P152fsc.455_456insCFrame_Shift_Ins60.22HGC27N000Y
TP53HLQAVTAHDPANCREAS162p.P152fsc.455_456insCFrame_Shift_Ins60.22KP3N000Y
TP53HPRPRHGHLSTOMACH155p.P152fsc.455_456insCFrame_Shift_Ins60.22HGC27Y14120N
TP53HPRPRHGHLPANCREAS155p.P152fsc.455_456insCFrame_Shift_Ins60.22KP3Y14120N
TP53KEETTGWRIHAEMATOPOIETIC_AND_LYMPHOID_TISSUE319p.Q317fsc.949_950insCFrame_Shift_Ins60.22MEC1N800N
TP53KEETTGWRIOESOPHAGUS319p.N310fsc.929_930insAFrame_Shift_Ins60.22OE19N800N
TP53LQAVTAHDGSTOMACH163p.P152fsc.455_456insCFrame_Shift_Ins60.22HGC27N002N
TP53LQAVTAHDGPANCREAS163p.P152fsc.455_456insCFrame_Shift_Ins60.22KP3N002N
TP53LSPFAVPSNLUNG32p.L35fsc.104_105insTFrame_Shift_Ins60.22NCIH1339N000N
TP53LSPFAVPSNLUNG32p.L35fsc.104_105insTFrame_Shift_Ins60.22NCIH1648N000N
TP53LWVDSTPPASTOMACH145p.P152fsc.455_456insCFrame_Shift_Ins10.22HGC27N1010N
TP53LWVDSTPPAPANCREAS145p.P152fsc.455_456insCFrame_Shift_Ins10.22KP3N1010N
TP53MGGMNRRPNOESOPHAGUS243p.I251fsc.751_752insAFrame_Shift_Ins10.22KYSE70N0013N
TP53NNVLSPFAVLUNG29p.L35fsc.104_105insTFrame_Shift_Ins30.22NCIH1339Y1130N
TP53NNVLSPFAVLUNG29p.L35fsc.104_105insTFrame_Shift_Ins30.22NCIH1648Y1130N
TP53NVLSPFAVPLUNG30p.L35fsc.104_105insTFrame_Shift_Ins40.22NCIH1339N000N
TP53NVLSPFAVPLUNG30p.L35fsc.104_105insTFrame_Shift_Ins40.22NCIH1648N000N
TP53PAKEETTGWHAEMATOPOIETIC_AND_LYMPHOID_TISSUE317p.Q317fsc.949_950insCFrame_Shift_Ins60.22MEC1N100N
TP53PAKEETTGWOESOPHAGUS317p.N310fsc.929_930insAFrame_Shift_Ins60.22OE19N100N
TP53PARHPRPRHSTOMACH152p.P152fsc.455_456insCFrame_Shift_Ins60.22HGC27N000N
TP53PARHPRPRHPANCREAS152p.P152fsc.455_456insCFrame_Shift_Ins60.22KP3N000N
TP53PENNVLSPFLUNG27p.L35fsc.104_105insTFrame_Shift_Ins10.22NCIH1339N100N
TP53PENNVLSPFLUNG27p.L35fsc.104_105insTFrame_Shift_Ins10.22NCIH1648N100N
TP53PHHHHTGRLOESOPHAGUS252p.I251fsc.751_752insAFrame_Shift_Ins60.22KYSE70N200N
TP53PPARHPRPRSTOMACH151p.P152fsc.455_456insCFrame_Shift_Ins50.22HGC27N100N
TP53PPARHPRPRPANCREAS151p.P152fsc.455_456insCFrame_Shift_Ins50.22KP3N100N
TP53PRHGHLQAVSTOMACH158p.P152fsc.455_456insCFrame_Shift_Ins60.22HGC27N400N
TP53PRHGHLQAVPANCREAS158p.P152fsc.455_456insCFrame_Shift_Ins60.22KP3N400N
TP53PRPRHGHLQSTOMACH156p.P152fsc.455_456insCFrame_Shift_Ins60.22HGC27N000N
TP53PRPRHGHLQPANCREAS156p.P152fsc.455_456insCFrame_Shift_Ins60.22KP3N000N
TP53PTGQDLPCAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE136p.Q136fsc.406_407insCFrame_Shift_Ins60.22K562N000N
TP53QAVTAHDGGSTOMACH164p.P152fsc.455_456insCFrame_Shift_Ins60.22HGC27N000N
TP53QAVTAHDGGPANCREAS164p.P152fsc.455_456insCFrame_Shift_Ins60.22KP3N000N
TP53QDLPCAAVGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE139p.Q136fsc.406_407insCFrame_Shift_Ins60.22K562N000N
TP53RHGHLQAVTSTOMACH159p.P152fsc.455_456insCFrame_Shift_Ins50.22HGC27N100N
TP53RHGHLQAVTPANCREAS159p.P152fsc.455_456insCFrame_Shift_Ins50.22KP3N100N
TP53RHPRPRHGHSTOMACH154p.P152fsc.455_456insCFrame_Shift_Ins70.22HGC27N000N
TP53RHPRPRHGHPANCREAS154p.P152fsc.455_456insCFrame_Shift_Ins70.22KP3N000N
TP53RPRHGHLQASTOMACH157p.P152fsc.455_456insCFrame_Shift_Ins60.22HGC27N800N
TP53RPRHGHLQAPANCREAS157p.P152fsc.455_456insCFrame_Shift_Ins60.22KP3N800N
TP53SPFAVPSNGLUNG33p.L35fsc.104_105insTFrame_Shift_Ins60.22NCIH1339N100N
TP53SPFAVPSNGLUNG33p.L35fsc.104_105insTFrame_Shift_Ins60.22NCIH1648N100N
TP53STPPARHPRSTOMACH149p.P152fsc.455_456insCFrame_Shift_Ins50.22HGC27N500N
TP53STPPARHPRPANCREAS149p.P152fsc.455_456insCFrame_Shift_Ins50.22KP3N500N
TP53TAHDGGCEASTOMACH167p.P152fsc.455_456insCFrame_Shift_Ins50.22HGC27N200N
TP53TAHDGGCEAPANCREAS167p.P152fsc.455_456insCFrame_Shift_Ins50.22KP3N200N
TP53TGQDLPCAAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE137p.Q136fsc.406_407insCFrame_Shift_Ins60.22K562N100N
TP53TGWRIFHPSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE323p.Q317fsc.949_950insCFrame_Shift_Ins60.22MEC1N000N
TP53TGWRIFHPSOESOPHAGUS323p.N310fsc.929_930insAFrame_Shift_Ins60.22OE19N000N
TP53TPPARHPRPSTOMACH150p.P152fsc.455_456insCFrame_Shift_Ins40.22HGC27N000Y
TP53TPPARHPRPPANCREAS150p.P152fsc.455_456insCFrame_Shift_Ins40.22KP3N000Y
TP53TTGWRIFHPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE322p.Q317fsc.949_950insCFrame_Shift_Ins70.22MEC1N000N
TP53TTGWRIFHPOESOPHAGUS322p.N310fsc.929_930insAFrame_Shift_Ins70.22OE19N000N
TP53VDSTPPARHSTOMACH147p.P152fsc.455_456insCFrame_Shift_Ins30.22HGC27N000N
TP53VDSTPPARHPANCREAS147p.P152fsc.455_456insCFrame_Shift_Ins30.22KP3N000N
TP53VLSPFAVPSLUNG31p.L35fsc.104_105insTFrame_Shift_Ins50.22NCIH1339N100N
TP53VLSPFAVPSLUNG31p.L35fsc.104_105insTFrame_Shift_Ins50.22NCIH1648N100N
TP53VTAHDGGCESTOMACH166p.P152fsc.455_456insCFrame_Shift_Ins60.22HGC27N000N
TP53VTAHDGGCEPANCREAS166p.P152fsc.455_456insCFrame_Shift_Ins60.22KP3N000N
TP53WVDSTPPARSTOMACH146p.P152fsc.455_456insCFrame_Shift_Ins20.22HGC27Y894N
TP53WVDSTPPARPANCREAS146p.P152fsc.455_456insCFrame_Shift_Ins20.22KP3Y894N
TP53GWRIFHPSDHAEMATOPOIETIC_AND_LYMPHOID_TISSUE324p.Q317fsc.949_950insCFrame_Shift_Ins60.33MEC1N000N
TP53GWRIFHPSDOESOPHAGUS324p.N310fsc.929_930insAFrame_Shift_Ins60.33OE19N000N
TP53IFHPSDPWAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE327p.Q317fsc.949_950insCFrame_Shift_Ins60.33MEC1N200N
TP53IFHPSDPWAOESOPHAGUS327p.N310fsc.929_930insAFrame_Shift_Ins60.33OE19N200N
TP53RIFHPSDPWHAEMATOPOIETIC_AND_LYMPHOID_TISSUE326p.Q317fsc.949_950insCFrame_Shift_Ins60.33MEC1N400N
TP53RIFHPSDPWOESOPHAGUS326p.N310fsc.929_930insAFrame_Shift_Ins60.33OE19N400N
TP53WRIFHPSDPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE325p.Q317fsc.949_950insCFrame_Shift_Ins60.33MEC1N2033N
TP53WRIFHPSDPOESOPHAGUS325p.N310fsc.929_930insAFrame_Shift_Ins60.33OE19N2033N
TP53ENISPFRSVSKIN326p.K321fsc.963_964insAAFrame_Shift_Ins60.55COLO741Y1140N
TP53FRSVGVSASSKIN331p.K321fsc.963_964insAAFrame_Shift_Ins60.55COLO741N4038N
TP53GVSASRCSESKIN335p.K321fsc.963_964insAAFrame_Shift_Ins50.55COLO741N000N
TP53HWMENISPFSKIN323p.K321fsc.963_964insAAFrame_Shift_Ins60.55COLO741N400N
TP53ISPFRSVGVSKIN328p.K321fsc.963_964insAAFrame_Shift_Ins60.55COLO741Y6112N
TP53MENISPFRSSKIN325p.K321fsc.963_964insAAFrame_Shift_Ins60.55COLO741N3018N
TP53NHWMENISPSKIN322p.K321fsc.963_964insAAFrame_Shift_Ins60.55COLO741N000N
TP53NISPFRSVGSKIN327p.K321fsc.963_964insAAFrame_Shift_Ins60.55COLO741N000N
TP53PFRSVGVSASKIN330p.K321fsc.963_964insAAFrame_Shift_Ins60.55COLO741N000N
TP53RSVGVSASRSKIN332p.K321fsc.963_964insAAFrame_Shift_Ins50.55COLO741N400N
TP53SPFRSVGVSSKIN329p.K321fsc.963_964insAAFrame_Shift_Ins60.55COLO741N400N
TP53SVGVSASRCSKIN333p.K321fsc.963_964insAAFrame_Shift_Ins50.55COLO741N000N
TP53VGVSASRCSSKIN334p.K321fsc.963_964insAAFrame_Shift_Ins50.55COLO741N007N
TP53VSASRCSESSKIN336p.K321fsc.963_964insAAFrame_Shift_Ins50.55COLO741N000N
TP53WMENISPFRSKIN324p.K321fsc.963_964insAAFrame_Shift_Ins60.55COLO741N1000N
TP53ACPGRDRRELUNG276p.TEE284delc.850_858delACAGAGGAAIn_Frame_Del10.11HCC1833N000N
TP53AKTCPVQLCCENTRAL_NERVOUS_SYSTEM138p.146_149WVDS>Cc.438_446delGGTTGATTCIn_Frame_Del10.11YKG1N100N
TP53ALIRVEGNLLIVER189p.PPQH190delc.569_580delCTCCTCAGCATCIn_Frame_Del10.11JHH5Y12160N
TP53CPGRDRRENLUNG277p.TEE284delc.850_858delACAGAGGAAIn_Frame_Del20.11HCC1833N300N
TP53CPVQLCTPPCENTRAL_NERVOUS_SYSTEM141p.146_149WVDS>Cc.438_446delGGTTGATTCIn_Frame_Del40.11YKG1N000N
TP53CTPPPGTRVCENTRAL_NERVOUS_SYSTEM146p.146_149WVDS>Cc.438_446delGGTTGATTCIn_Frame_Del10.11YKG1Y290N
TP53CTTIYNYMCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE229p.H233delc.697_699delCACIn_Frame_Del30.11MEG01N100N
TP53DCTTIYNYMHAEMATOPOIETIC_AND_LYMPHOID_TISSUE228p.H233delc.697_699delCACIn_Frame_Del40.11MEG01Y290Y
TP53DDRNTFRHVBONE207p.S215delc.643_645delAGTIn_Frame_Del10.11MHHES1Y4100Y
TP53DGLALIRVELIVER186p.PPQH190delc.569_580delCTCCTCAGCATCIn_Frame_Del40.11JHH5N000N
TP53DRNTFRHVVBONE208p.S215delc.643_645delAGTIn_Frame_Del10.11MHHES1Y490N
TP53DRRENLRKKLUNG281p.TEE284delc.850_858delACAGAGGAAIn_Frame_Del30.11HCC1833Y190N
TP53DRRTENLRKBONE281p.EE286delc.856_861delGAAGAGIn_Frame_Del40.11CAL78N200N
TP53DSDGLALIRLIVER184p.PPQH190delc.569_580delCTCCTCAGCATCIn_Frame_Del30.11JHH5N400N
TP53EVGRCPHHEUPPER_AERODIGESTIVE_TRACT171p.173_174VR>Gc.518_520delTGAIn_Frame_Del20.11BICR31N000N
TP53FRHVVVPYEBONE212p.S215delc.643_645delAGTIn_Frame_Del30.11MHHES1N3014N
TP53GLALIRVEGLIVER187p.PPQH190delc.569_580delCTCCTCAGCATCIn_Frame_Del30.11JHH5N000N
TP53GRCPHHERCUPPER_AERODIGESTIVE_TRACT173p.173_174VR>Gc.518_520delTGAIn_Frame_Del10.11BICR31N200N
TP53GRDRRENLRLUNG279p.TEE284delc.850_858delACAGAGGAAIn_Frame_Del40.11HCC1833Y390N
TP53GRDRRTENLBONE279p.EE286delc.856_861delGAAGAGIn_Frame_Del20.11CAL78Y6100N
TP53GSDCTTIYNHAEMATOPOIETIC_AND_LYMPHOID_TISSUE226p.H233delc.697_699delCACIn_Frame_Del20.11MEG01N100Y
TP53HMTEVGRCPUPPER_AERODIGESTIVE_TRACT168p.173_174VR>Gc.518_520delTGAIn_Frame_Del30.11BICR31N000N
TP53HVVVPYEPPBONE214p.S215delc.643_645delAGTIn_Frame_Del10.11MHHES1N100N
TP53IYNYMCNSSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE232p.H233delc.697_699delCACIn_Frame_Del10.11MEG01N2021N
TP53KTCPVQLCTCENTRAL_NERVOUS_SYSTEM139p.146_149WVDS>Cc.438_446delGGTTGATTCIn_Frame_Del20.11YKG1N200N
TP53LALIRVEGNLIVER188p.PPQH190delc.569_580delCTCCTCAGCATCIn_Frame_Del20.11JHH5N201N
TP53LCTPPPGTRCENTRAL_NERVOUS_SYSTEM145p.146_149WVDS>Cc.438_446delGGTTGATTCIn_Frame_Del20.11YKG1N300N
TP53MTEVGRCPHUPPER_AERODIGESTIVE_TRACT169p.173_174VR>Gc.518_520delTGAIn_Frame_Del40.11BICR31N100N
TP53NTFRHVVVPBONE210p.S215delc.643_645delAGTIn_Frame_Del20.11MHHES1N000N
TP53PGRDRRENLLUNG278p.TEE284delc.850_858delACAGAGGAAIn_Frame_Del30.11HCC1833N400N
TP53PGRDRRTENBONE278p.EE286delc.856_861delGAAGAGIn_Frame_Del10.11CAL78N000N
TP53PVQLCTPPPCENTRAL_NERVOUS_SYSTEM142p.146_149WVDS>Cc.438_446delGGTTGATTCIn_Frame_Del50.11YKG1N000N
TP53QHMTEVGRCUPPER_AERODIGESTIVE_TRACT167p.173_174VR>Gc.518_520delTGAIn_Frame_Del20.11BICR31N200N
TP53QLCTPPPGTCENTRAL_NERVOUS_SYSTEM144p.146_149WVDS>Cc.438_446delGGTTGATTCIn_Frame_Del30.11YKG1N300Y
TP53QSQHMTEVGUPPER_AERODIGESTIVE_TRACT165p.173_174VR>Gc.518_520delTGAIn_Frame_Del10.11BICR31N000N
TP53RDRRENLRKLUNG280p.TEE284delc.850_858delACAGAGGAAIn_Frame_Del30.11HCC1833N000N
TP53RDRRTENLRBONE280p.EE286delc.856_861delGAAGAGIn_Frame_Del30.11CAL78N100N
TP53RENLRKKGELUNG283p.TEE284delc.850_858delACAGAGGAAIn_Frame_Del10.11HCC1833N000N
TP53RHVVVPYEPBONE213p.S215delc.643_645delAGTIn_Frame_Del20.11MHHES1N000N
TP53RNTFRHVVVBONE209p.S215delc.643_645delAGTIn_Frame_Del10.11MHHES1N300N
TP53RRENLRKKGLUNG282p.TEE284delc.850_858delACAGAGGAAIn_Frame_Del20.11HCC1833N100Y
TP53RRTENLRKKBONE282p.EE286delc.856_861delGAAGAGIn_Frame_Del30.11CAL78N200N
TP53RTENLRKKGBONE283p.EE286delc.856_861delGAAGAGIn_Frame_Del20.11CAL78N200N
TP53SDCTTIYNYHAEMATOPOIETIC_AND_LYMPHOID_TISSUE227p.H233delc.697_699delCACIn_Frame_Del30.11MEG01N300N
TP53SDGLALIRVLIVER185p.PPQH190delc.569_580delCTCCTCAGCATCIn_Frame_Del40.11JHH5Y490N
TP53SDSDGLALILIVER183p.PPQH190delc.569_580delCTCCTCAGCATCIn_Frame_Del20.11JHH5Y390N
TP53SQHMTEVGRUPPER_AERODIGESTIVE_TRACT166p.173_174VR>Gc.518_520delTGAIn_Frame_Del10.11BICR31N500N
TP53TCPVQLCTPCENTRAL_NERVOUS_SYSTEM140p.146_149WVDS>Cc.438_446delGGTTGATTCIn_Frame_Del30.11YKG1N000N
TP53TENLRKKGEBONE284p.EE286delc.856_861delGAAGAGIn_Frame_Del10.11CAL78N000N
TP53TEVGRCPHHUPPER_AERODIGESTIVE_TRACT170p.173_174VR>Gc.518_520delTGAIn_Frame_Del30.11BICR31N100N
TP53TFRHVVVPYBONE211p.S215delc.643_645delAGTIn_Frame_Del30.11MHHES1Y3110N
TP53TIYNYMCNSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE231p.H233delc.697_699delCACIn_Frame_Del20.11MEG01N000N
TP53TTIYNYMCNHAEMATOPOIETIC_AND_LYMPHOID_TISSUE230p.H233delc.697_699delCACIn_Frame_Del20.11MEG01N200N
TP53VGRCPHHERUPPER_AERODIGESTIVE_TRACT172p.173_174VR>Gc.518_520delTGAIn_Frame_Del10.11BICR31N102N
TP53VGSDCTTIYHAEMATOPOIETIC_AND_LYMPHOID_TISSUE225p.H233delc.697_699delCACIn_Frame_Del10.11MEG01N7011Y
TP53VQLCTPPPGCENTRAL_NERVOUS_SYSTEM143p.146_149WVDS>Cc.438_446delGGTTGATTCIn_Frame_Del40.11YKG1N008Y
TP53CSDSDGLALLIVER182p.PPQH190delc.569_580delCTCCTCAGCATCIn_Frame_Del10.22JHH5N800N
TP53FRHSVVPYELUNG212p.V218delc.652_654delGTGIn_Frame_Del30.22HCC827N3017N
TP53FRHSVVPYEENDOMETRIUM212p.V218delc.652_654delGTGIn_Frame_Del30.22RL952N3017N
TP53HSVVPYEPPLUNG214p.V218delc.652_654delGTGIn_Frame_Del20.22HCC827N100Y
TP53HSVVPYEPPENDOMETRIUM214p.V218delc.652_654delGTGIn_Frame_Del20.22RL952N100Y
TP53NTFRHSVVPLUNG210p.V218delc.652_654delGTGIn_Frame_Del10.22HCC827N000N
TP53NTFRHSVVPENDOMETRIUM210p.V218delc.652_654delGTGIn_Frame_Del10.22RL952N000N
TP53RHSVVPYEPLUNG213p.V218delc.652_654delGTGIn_Frame_Del30.22HCC827N000N
TP53RHSVVPYEPENDOMETRIUM213p.V218delc.652_654delGTGIn_Frame_Del30.22RL952N000N
TP53SVVPYEPPELUNG215p.V218delc.652_654delGTGIn_Frame_Del10.22HCC827N000Y
TP53SVVPYEPPEENDOMETRIUM215p.V218delc.652_654delGTGIn_Frame_Del10.22RL952N000Y
TP53TFRHSVVPYLUNG211p.V218delc.652_654delGTGIn_Frame_Del20.22HCC827N300N
TP53TFRHSVVPYENDOMETRIUM211p.V218delc.652_654delGTGIn_Frame_Del20.22RL952N300N
TP53AIYKQYKQSLUNG161p.165_166insYKQc.496_497insACAAGCAGTIn_Frame_Ins40.11NCIH727N100N
TP53AMAIYKQYKLUNG159p.165_166insYKQc.496_497insACAAGCAGTIn_Frame_Ins20.11NCIH727N600N
TP53IYKQYKQSQLUNG162p.165_166insYKQc.496_497insACAAGCAGTIn_Frame_Ins40.11NCIH727N0011N
TP53KQYKQSQHMLUNG164p.165_166insYKQc.496_497insACAAGCAGTIn_Frame_Ins20.11NCIH727N1000N
TP53MAIYKQYKQLUNG160p.165_166insYKQc.496_497insACAAGCAGTIn_Frame_Ins30.11NCIH727N0010N
TP53QYKQSQHMTLUNG165p.165_166insYKQc.496_497insACAAGCAGTIn_Frame_Ins10.11NCIH727N200N
TP53RAMAIYKQYLUNG158p.165_166insYKQc.496_497insACAAGCAGTIn_Frame_Ins10.11NCIH727N700N
TP53YKQYKQSQHLUNG163p.165_166insYKQc.496_497insACAAGCAGTIn_Frame_Ins30.11NCIH727N304N
TP53CEPPEVGSDPANCREAS220p.Y220Cc.659A>GMissense_Mutation11.33BXPC3N100Y
TP53CEPPEVGSDOVARY220p.Y220Cc.659A>GMissense_Mutation11.33COV362N100Y
TP53CEPPEVGSDBREAST220p.Y220Cc.659A>GMissense_Mutation11.33HCC1419N100Y
TP53CEPPEVGSDLUNG220p.Y220Cc.659A>GMissense_Mutation11.33HCC2935N100Y
TP53CEPPEVGSDLUNG220p.Y220Cc.659A>GMissense_Mutation11.33HCC366N100Y
TP53CEPPEVGSDLIVER220p.Y220Cc.659A>GMissense_Mutation11.33HUH7N100Y
TP53CEPPEVGSDENDOMETRIUM220p.Y220Cc.659A>GMissense_Mutation11.33MFE296N100Y
TP53CEPPEVGSDENDOMETRIUM220p.Y220Cc.659A>GMissense_Mutation11.33MFE319N100Y
TP53CEPPEVGSDLUNG220p.Y220Cc.659A>GMissense_Mutation11.33NCIH2342N100Y
TP53CEPPEVGSDSTOMACH220p.Y220Cc.659A>GMissense_Mutation11.33NUGC3N100Y
TP53CEPPEVGSDPANCREAS220p.Y220Cc.659A>GMissense_Mutation11.33T3M4N100Y
TP53CEPPEVGSDOESOPHAGUS220p.Y220Cc.659A>GMissense_Mutation11.33TE8N100Y
TP53FRHSVVVPCPANCREAS212p.Y220Cc.659A>GMissense_Mutation11.33BXPC3N4031N
TP53FRHSVVVPCOVARY212p.Y220Cc.659A>GMissense_Mutation11.33COV362N4031N
TP53FRHSVVVPCBREAST212p.Y220Cc.659A>GMissense_Mutation11.33HCC1419N4031N
TP53FRHSVVVPCLUNG212p.Y220Cc.659A>GMissense_Mutation11.33HCC2935N4031N
TP53FRHSVVVPCLUNG212p.Y220Cc.659A>GMissense_Mutation11.33HCC366N4031N
TP53FRHSVVVPCLIVER212p.Y220Cc.659A>GMissense_Mutation11.33HUH7N4031N
TP53FRHSVVVPCENDOMETRIUM212p.Y220Cc.659A>GMissense_Mutation11.33MFE296N4031N
TP53FRHSVVVPCENDOMETRIUM212p.Y220Cc.659A>GMissense_Mutation11.33MFE319N4031N
TP53FRHSVVVPCLUNG212p.Y220Cc.659A>GMissense_Mutation11.33NCIH2342N4031N
TP53FRHSVVVPCSTOMACH212p.Y220Cc.659A>GMissense_Mutation11.33NUGC3N4031N
TP53FRHSVVVPCPANCREAS212p.Y220Cc.659A>GMissense_Mutation11.33T3M4N4031N
TP53FRHSVVVPCOESOPHAGUS212p.Y220Cc.659A>GMissense_Mutation11.33TE8N4031N
TP53HSVVVPCEPPANCREAS214p.Y220Cc.659A>GMissense_Mutation11.33BXPC3N000N
TP53HSVVVPCEPOVARY214p.Y220Cc.659A>GMissense_Mutation11.33COV362N000N
TP53HSVVVPCEPBREAST214p.Y220Cc.659A>GMissense_Mutation11.33HCC1419N000N
TP53HSVVVPCEPLUNG214p.Y220Cc.659A>GMissense_Mutation11.33HCC2935N000N
TP53HSVVVPCEPLUNG214p.Y220Cc.659A>GMissense_Mutation11.33HCC366N000N
TP53HSVVVPCEPLIVER214p.Y220Cc.659A>GMissense_Mutation11.33HUH7N000N
TP53HSVVVPCEPENDOMETRIUM214p.Y220Cc.659A>GMissense_Mutation11.33MFE296N000N
TP53HSVVVPCEPENDOMETRIUM214p.Y220Cc.659A>GMissense_Mutation11.33MFE319N000N
TP53HSVVVPCEPLUNG214p.Y220Cc.659A>GMissense_Mutation11.33NCIH2342N000N
TP53HSVVVPCEPSTOMACH214p.Y220Cc.659A>GMissense_Mutation11.33NUGC3N000N
TP53HSVVVPCEPPANCREAS214p.Y220Cc.659A>GMissense_Mutation11.33T3M4N000N
TP53HSVVVPCEPOESOPHAGUS214p.Y220Cc.659A>GMissense_Mutation11.33TE8N000N
TP53PCEPPEVGSPANCREAS219p.Y220Cc.659A>GMissense_Mutation11.33BXPC3N100N
TP53PCEPPEVGSOVARY219p.Y220Cc.659A>GMissense_Mutation11.33COV362N100N
TP53PCEPPEVGSBREAST219p.Y220Cc.659A>GMissense_Mutation11.33HCC1419N100N
TP53PCEPPEVGSLUNG219p.Y220Cc.659A>GMissense_Mutation11.33HCC2935N100N
TP53PCEPPEVGSLUNG219p.Y220Cc.659A>GMissense_Mutation11.33HCC366N100N
TP53PCEPPEVGSLIVER219p.Y220Cc.659A>GMissense_Mutation11.33HUH7N100N
TP53PCEPPEVGSENDOMETRIUM219p.Y220Cc.659A>GMissense_Mutation11.33MFE296N100N
TP53PCEPPEVGSENDOMETRIUM219p.Y220Cc.659A>GMissense_Mutation11.33MFE319N100N
TP53PCEPPEVGSLUNG219p.Y220Cc.659A>GMissense_Mutation11.33NCIH2342N100N
TP53PCEPPEVGSSTOMACH219p.Y220Cc.659A>GMissense_Mutation11.33NUGC3N100N
TP53PCEPPEVGSPANCREAS219p.Y220Cc.659A>GMissense_Mutation11.33T3M4N100N
TP53PCEPPEVGSOESOPHAGUS219p.Y220Cc.659A>GMissense_Mutation11.33TE8N100N
TP53RHSVVVPCEPANCREAS213p.Y220Cc.659A>GMissense_Mutation11.33BXPC3N000N
TP53RHSVVVPCEOVARY213p.Y220Cc.659A>GMissense_Mutation11.33COV362N000N
TP53RHSVVVPCEBREAST213p.Y220Cc.659A>GMissense_Mutation11.33HCC1419N000N
TP53RHSVVVPCELUNG213p.Y220Cc.659A>GMissense_Mutation11.33HCC2935N000N
TP53RHSVVVPCELUNG213p.Y220Cc.659A>GMissense_Mutation11.33HCC366N000N
TP53RHSVVVPCELIVER213p.Y220Cc.659A>GMissense_Mutation11.33HUH7N000N
TP53RHSVVVPCEENDOMETRIUM213p.Y220Cc.659A>GMissense_Mutation11.33MFE296N000N
TP53RHSVVVPCEENDOMETRIUM213p.Y220Cc.659A>GMissense_Mutation11.33MFE319N000N
TP53RHSVVVPCELUNG213p.Y220Cc.659A>GMissense_Mutation11.33NCIH2342N000N
TP53RHSVVVPCESTOMACH213p.Y220Cc.659A>GMissense_Mutation11.33NUGC3N000N
TP53RHSVVVPCEPANCREAS213p.Y220Cc.659A>GMissense_Mutation11.33T3M4N000N
TP53RHSVVVPCEOESOPHAGUS213p.Y220Cc.659A>GMissense_Mutation11.33TE8N000N
TP53SVVVPCEPPPANCREAS215p.Y220Cc.659A>GMissense_Mutation11.33BXPC3N000Y
TP53SVVVPCEPPOVARY215p.Y220Cc.659A>GMissense_Mutation11.33COV362N000Y
TP53SVVVPCEPPBREAST215p.Y220Cc.659A>GMissense_Mutation11.33HCC1419N000Y
TP53SVVVPCEPPLUNG215p.Y220Cc.659A>GMissense_Mutation11.33HCC2935N000Y
TP53SVVVPCEPPLUNG215p.Y220Cc.659A>GMissense_Mutation11.33HCC366N000Y
TP53SVVVPCEPPLIVER215p.Y220Cc.659A>GMissense_Mutation11.33HUH7N000Y
TP53SVVVPCEPPENDOMETRIUM215p.Y220Cc.659A>GMissense_Mutation11.33MFE296N000Y
TP53SVVVPCEPPENDOMETRIUM215p.Y220Cc.659A>GMissense_Mutation11.33MFE319N000Y
TP53SVVVPCEPPLUNG215p.Y220Cc.659A>GMissense_Mutation11.33NCIH2342N000Y
TP53SVVVPCEPPSTOMACH215p.Y220Cc.659A>GMissense_Mutation11.33NUGC3N000Y
TP53SVVVPCEPPPANCREAS215p.Y220Cc.659A>GMissense_Mutation11.33T3M4N000Y
TP53SVVVPCEPPOESOPHAGUS215p.Y220Cc.659A>GMissense_Mutation11.33TE8N000Y
TP53VPCEPPEVGPANCREAS218p.Y220Cc.659A>GMissense_Mutation11.33BXPC3N100Y
TP53VPCEPPEVGOVARY218p.Y220Cc.659A>GMissense_Mutation11.33COV362N100Y
TP53VPCEPPEVGBREAST218p.Y220Cc.659A>GMissense_Mutation11.33HCC1419N100Y
TP53VPCEPPEVGLUNG218p.Y220Cc.659A>GMissense_Mutation11.33HCC2935N100Y
TP53VPCEPPEVGLUNG218p.Y220Cc.659A>GMissense_Mutation11.33HCC366N100Y
TP53VPCEPPEVGLIVER218p.Y220Cc.659A>GMissense_Mutation11.33HUH7N100Y
TP53VPCEPPEVGENDOMETRIUM218p.Y220Cc.659A>GMissense_Mutation11.33MFE296N100Y
TP53VPCEPPEVGENDOMETRIUM218p.Y220Cc.659A>GMissense_Mutation11.33MFE319N100Y
TP53VPCEPPEVGLUNG218p.Y220Cc.659A>GMissense_Mutation11.33NCIH2342N100Y
TP53VPCEPPEVGSTOMACH218p.Y220Cc.659A>GMissense_Mutation11.33NUGC3N100Y
TP53VPCEPPEVGPANCREAS218p.Y220Cc.659A>GMissense_Mutation11.33T3M4N100Y
TP53VPCEPPEVGOESOPHAGUS218p.Y220Cc.659A>GMissense_Mutation11.33TE8N100Y
TP53VVPCEPPEVPANCREAS217p.Y220Cc.659A>GMissense_Mutation11.33BXPC3N5014Y
TP53VVPCEPPEVOVARY217p.Y220Cc.659A>GMissense_Mutation11.33COV362N5014Y
TP53VVPCEPPEVBREAST217p.Y220Cc.659A>GMissense_Mutation11.33HCC1419N5014Y
TP53VVPCEPPEVLUNG217p.Y220Cc.659A>GMissense_Mutation11.33HCC2935N5014Y
TP53VVPCEPPEVLUNG217p.Y220Cc.659A>GMissense_Mutation11.33HCC366N5014Y
TP53VVPCEPPEVLIVER217p.Y220Cc.659A>GMissense_Mutation11.33HUH7N5014Y
TP53VVPCEPPEVENDOMETRIUM217p.Y220Cc.659A>GMissense_Mutation11.33MFE296N5014Y
TP53VVPCEPPEVENDOMETRIUM217p.Y220Cc.659A>GMissense_Mutation11.33MFE319N5014Y
TP53VVPCEPPEVLUNG217p.Y220Cc.659A>GMissense_Mutation11.33NCIH2342N5014Y
TP53VVPCEPPEVSTOMACH217p.Y220Cc.659A>GMissense_Mutation11.33NUGC3N5014Y
TP53VVPCEPPEVPANCREAS217p.Y220Cc.659A>GMissense_Mutation11.33T3M4N5014Y
TP53VVPCEPPEVOESOPHAGUS217p.Y220Cc.659A>GMissense_Mutation11.33TE8N5014Y
TP53VVVPCEPPEPANCREAS216p.Y220Cc.659A>GMissense_Mutation11.33BXPC3N000Y
TP53VVVPCEPPEOVARY216p.Y220Cc.659A>GMissense_Mutation11.33COV362N000Y
TP53VVVPCEPPEBREAST216p.Y220Cc.659A>GMissense_Mutation11.33HCC1419N000Y
TP53VVVPCEPPELUNG216p.Y220Cc.659A>GMissense_Mutation11.33HCC2935N000Y
TP53VVVPCEPPELUNG216p.Y220Cc.659A>GMissense_Mutation11.33HCC366N000Y
TP53VVVPCEPPELIVER216p.Y220Cc.659A>GMissense_Mutation11.33HUH7N000Y
TP53VVVPCEPPEENDOMETRIUM216p.Y220Cc.659A>GMissense_Mutation11.33MFE296N000Y
TP53VVVPCEPPEENDOMETRIUM216p.Y220Cc.659A>GMissense_Mutation11.33MFE319N000Y
TP53VVVPCEPPELUNG216p.Y220Cc.659A>GMissense_Mutation11.33NCIH2342N000Y
TP53VVVPCEPPESTOMACH216p.Y220Cc.659A>GMissense_Mutation11.33NUGC3N000Y
TP53VVVPCEPPEPANCREAS216p.Y220Cc.659A>GMissense_Mutation11.33T3M4N000Y
TP53VVVPCEPPEOESOPHAGUS216p.Y220Cc.659A>GMissense_Mutation11.33TE8N000Y
TP53CMGGMNWRPKIDNEY242p.R248Wc.742C>TMissense_Mutation11.99786ON000N
TP53CMGGMNWRPCENTRAL_NERVOUS_SYSTEM242p.R248Wc.742C>TMissense_Mutation11.99CAS1N000N
TP53CMGGMNWRPLARGE_INTESTINE242p.R248Wc.742C>TMissense_Mutation11.99COLO320N000N
TP53CMGGMNWRPOESOPHAGUS242p.R248Wc.742C>TMissense_Mutation11.99COLO680NN000N
TP53CMGGMNWRPSOFT_TISSUE242p.R248Wc.741_742CC>TTMissense_Mutation11.99GCTN000N
TP53CMGGMNWRPBREAST242p.R248Wc.742C>TMissense_Mutation11.99HCC2157N000N
TP53CMGGMNWRPBREAST242p.R248Wc.742C>TMissense_Mutation11.99JIMT1N000N
TP53CMGGMNWRPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE242p.R248Wc.742C>TMissense_Mutation11.99KO52N000N
TP53CMGGMNWRPLUNG242p.R248Wc.742C>TMissense_Mutation11.99LUDLU1N000N
TP53CMGGMNWRPLUNG242p.R248Wc.742C>TMissense_Mutation11.99LXF289N000N
TP53CMGGMNWRPPANCREAS242p.R248Wc.742C>TMissense_Mutation11.99MIAPACA2N000N
TP53CMGGMNWRPLUNG242p.R248Wc.741_742CC>TTMissense_Mutation11.99NCIH2106N000N
TP53CMGGMNWRPSOFT_TISSUE242p.R248Wc.742C>TMissense_Mutation11.99RDN000N
TP53CMGGMNWRPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE242p.R248Wc.742C>TMissense_Mutation11.99SET2N000N
TP53CMGGMNWRPLARGE_INTESTINE242p.R248Wc.742C>TMissense_Mutation11.99SNU1040N000N
TP53CMGGMNWRPLARGE_INTESTINE242p.R248Wc.742C>TMissense_Mutation11.99SNUC5N000N
TP53CMGGMNWRPLARGE_INTESTINE242p.R248Wc.742C>TMissense_Mutation11.99SW837N000N
TP53CMGGMNWRPPROSTATE242p.R248Wc.742C>TMissense_Mutation11.99VCAPN000N
TP53CVCACPGRDTHYROID273p.R273Cc.817C>TMissense_Mutation11.998305CN000N
TP53CVCACPGRDCENTRAL_NERVOUS_SYSTEM273p.R273Cc.817C>TMissense_Mutation11.998MGBAN000N
TP53CVCACPGRDHAEMATOPOIETIC_AND_LYMPHOID_TISSUE273p.R273Cc.817C>TMissense_Mutation11.99BL70N000N
TP53CVCACPGRDLARGE_INTESTINE273p.R273Cc.817C>TMissense_Mutation11.99CL14N000N
TP53CVCACPGRDOVARY273p.R273Cc.817C>TMissense_Mutation11.99EFO27N000N
TP53CVCACPGRDHAEMATOPOIETIC_AND_LYMPHOID_TISSUE273p.R273Cc.817C>TMissense_Mutation11.99KARPAS299N000N
TP53CVCACPGRDENDOMETRIUM273p.R273Cc.817C>TMissense_Mutation11.99MFE319N000N
TP53CVCACPGRDLUNG273p.R273Cc.817C>TMissense_Mutation11.99NCIH1048N000N
TP53CVCACPGRDPANCREAS273p.R273Cc.817C>TMissense_Mutation11.99PANC0213N000N
TP53CVCACPGRDHAEMATOPOIETIC_AND_LYMPHOID_TISSUE273p.R273Cc.817C>TMissense_Mutation11.99RPMI8402N000N
TP53CVCACPGRDSTOMACH273p.R273Cc.817C>TMissense_Mutation11.99SH10TCN000N
TP53CVCACPGRDSOFT_TISSUE273p.R273Cc.817C>TMissense_Mutation11.99SJRH30N000N
TP53CVCACPGRDBILIARY_TRACT273p.R273Cc.817C>TMissense_Mutation11.99SNU1196N000N
TP53CVCACPGRDHAEMATOPOIETIC_AND_LYMPHOID_TISSUE273p.R273Cc.817C>TMissense_Mutation11.99SUDHL4N000N
TP53CVCACPGRDCENTRAL_NERVOUS_SYSTEM273p.R273Cc.817C>TMissense_Mutation11.99SW1088N000N
TP53CVCACPGRDURINARY_TRACT273p.R273Cc.817C>TMissense_Mutation11.99SW1710N000N
TP53CVCACPGRDSTOMACH273p.R273Cc.817C>TMissense_Mutation11.99TGBC11TKBN000N
TP53CVCACPGRDTHYROID273p.R273Cc.817C>TMissense_Mutation11.99TT2609C02N000N
TP53EVCVCACPGTHYROID271p.R273Cc.817C>TMissense_Mutation11.998305CN000N
TP53EVCVCACPGCENTRAL_NERVOUS_SYSTEM271p.R273Cc.817C>TMissense_Mutation11.998MGBAN000N
TP53EVCVCACPGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE271p.R273Cc.817C>TMissense_Mutation11.99BL70N000N
TP53EVCVCACPGLARGE_INTESTINE271p.R273Cc.817C>TMissense_Mutation11.99CL14N000N
TP53EVCVCACPGOVARY271p.R273Cc.817C>TMissense_Mutation11.99EFO27N000N
TP53EVCVCACPGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE271p.R273Cc.817C>TMissense_Mutation11.99KARPAS299N000N
TP53EVCVCACPGENDOMETRIUM271p.R273Cc.817C>TMissense_Mutation11.99MFE319N000N
TP53EVCVCACPGLUNG271p.R273Cc.817C>TMissense_Mutation11.99NCIH1048N000N
TP53EVCVCACPGPANCREAS271p.R273Cc.817C>TMissense_Mutation11.99PANC0213N000N
TP53EVCVCACPGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE271p.R273Cc.817C>TMissense_Mutation11.99RPMI8402N000N
TP53EVCVCACPGSTOMACH271p.R273Cc.817C>TMissense_Mutation11.99SH10TCN000N
TP53EVCVCACPGSOFT_TISSUE271p.R273Cc.817C>TMissense_Mutation11.99SJRH30N000N
TP53EVCVCACPGBILIARY_TRACT271p.R273Cc.817C>TMissense_Mutation11.99SNU1196N000N
TP53EVCVCACPGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE271p.R273Cc.817C>TMissense_Mutation11.99SUDHL4N000N
TP53EVCVCACPGCENTRAL_NERVOUS_SYSTEM271p.R273Cc.817C>TMissense_Mutation11.99SW1088N000N
TP53EVCVCACPGURINARY_TRACT271p.R273Cc.817C>TMissense_Mutation11.99SW1710N000N
TP53EVCVCACPGSTOMACH271p.R273Cc.817C>TMissense_Mutation11.99TGBC11TKBN000N
TP53EVCVCACPGTHYROID271p.R273Cc.817C>TMissense_Mutation11.99TT2609C02N000N
TP53FEVCVCACPTHYROID270p.R273Cc.817C>TMissense_Mutation11.998305CN300N
TP53FEVCVCACPCENTRAL_NERVOUS_SYSTEM270p.R273Cc.817C>TMissense_Mutation11.998MGBAN300N
TP53FEVCVCACPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE270p.R273Cc.817C>TMissense_Mutation11.99BL70N300N
TP53FEVCVCACPLARGE_INTESTINE270p.R273Cc.817C>TMissense_Mutation11.99CL14N300N
TP53FEVCVCACPOVARY270p.R273Cc.817C>TMissense_Mutation11.99EFO27N300N
TP53FEVCVCACPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE270p.R273Cc.817C>TMissense_Mutation11.99KARPAS299N300N
TP53FEVCVCACPENDOMETRIUM270p.R273Cc.817C>TMissense_Mutation11.99MFE319N300N
TP53FEVCVCACPLUNG270p.R273Cc.817C>TMissense_Mutation11.99NCIH1048N300N
TP53FEVCVCACPPANCREAS270p.R273Cc.817C>TMissense_Mutation11.99PANC0213N300N
TP53FEVCVCACPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE270p.R273Cc.817C>TMissense_Mutation11.99RPMI8402N300N
TP53FEVCVCACPSTOMACH270p.R273Cc.817C>TMissense_Mutation11.99SH10TCN300N
TP53FEVCVCACPSOFT_TISSUE270p.R273Cc.817C>TMissense_Mutation11.99SJRH30N300N
TP53FEVCVCACPBILIARY_TRACT270p.R273Cc.817C>TMissense_Mutation11.99SNU1196N300N
TP53FEVCVCACPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE270p.R273Cc.817C>TMissense_Mutation11.99SUDHL4N300N
TP53FEVCVCACPCENTRAL_NERVOUS_SYSTEM270p.R273Cc.817C>TMissense_Mutation11.99SW1088N300N
TP53FEVCVCACPURINARY_TRACT270p.R273Cc.817C>TMissense_Mutation11.99SW1710N300N
TP53FEVCVCACPSTOMACH270p.R273Cc.817C>TMissense_Mutation11.99TGBC11TKBN300N
TP53FEVCVCACPTHYROID270p.R273Cc.817C>TMissense_Mutation11.99TT2609C02N300N
TP53GGMNWRPILKIDNEY244p.R248Wc.742C>TMissense_Mutation11.99786ON1300N
TP53GGMNWRPILCENTRAL_NERVOUS_SYSTEM244p.R248Wc.742C>TMissense_Mutation11.99CAS1N1300N
TP53GGMNWRPILLARGE_INTESTINE244p.R248Wc.742C>TMissense_Mutation11.99COLO320N1300N
TP53GGMNWRPILOESOPHAGUS244p.R248Wc.742C>TMissense_Mutation11.99COLO680NN1300N
TP53GGMNWRPILSOFT_TISSUE244p.R248Wc.741_742CC>TTMissense_Mutation11.99GCTN1300N
TP53GGMNWRPILBREAST244p.R248Wc.742C>TMissense_Mutation11.99HCC2157N1300N
TP53GGMNWRPILBREAST244p.R248Wc.742C>TMissense_Mutation11.99JIMT1N1300N
TP53GGMNWRPILHAEMATOPOIETIC_AND_LYMPHOID_TISSUE244p.R248Wc.742C>TMissense_Mutation11.99KO52N1300N
TP53GGMNWRPILLUNG244p.R248Wc.742C>TMissense_Mutation11.99LUDLU1N1300N
TP53GGMNWRPILLUNG244p.R248Wc.742C>TMissense_Mutation11.99LXF289N1300N
TP53GGMNWRPILPANCREAS244p.R248Wc.742C>TMissense_Mutation11.99MIAPACA2N1300N
TP53GGMNWRPILLUNG244p.R248Wc.741_742CC>TTMissense_Mutation11.99NCIH2106N1300N
TP53GGMNWRPILSOFT_TISSUE244p.R248Wc.742C>TMissense_Mutation11.99RDN1300N
TP53GGMNWRPILHAEMATOPOIETIC_AND_LYMPHOID_TISSUE244p.R248Wc.742C>TMissense_Mutation11.99SET2N1300N
TP53GGMNWRPILLARGE_INTESTINE244p.R248Wc.742C>TMissense_Mutation11.99SNU1040N1300N
TP53GGMNWRPILLARGE_INTESTINE244p.R248Wc.742C>TMissense_Mutation11.99SNUC5N1300N
TP53GGMNWRPILLARGE_INTESTINE244p.R248Wc.742C>TMissense_Mutation11.99SW837N1300N
TP53GGMNWRPILPROSTATE244p.R248Wc.742C>TMissense_Mutation11.99VCAPN1300N
TP53GMNWRPILTKIDNEY245p.R248Wc.742C>TMissense_Mutation11.99786ON200N
TP53GMNWRPILTCENTRAL_NERVOUS_SYSTEM245p.R248Wc.742C>TMissense_Mutation11.99CAS1N200N
TP53GMNWRPILTLARGE_INTESTINE245p.R248Wc.742C>TMissense_Mutation11.99COLO320N200N
TP53GMNWRPILTOESOPHAGUS245p.R248Wc.742C>TMissense_Mutation11.99COLO680NN200N
TP53GMNWRPILTSOFT_TISSUE245p.R248Wc.741_742CC>TTMissense_Mutation11.99GCTN200N
TP53GMNWRPILTBREAST245p.R248Wc.742C>TMissense_Mutation11.99HCC2157N200N
TP53GMNWRPILTBREAST245p.R248Wc.742C>TMissense_Mutation11.99JIMT1N200N
TP53GMNWRPILTHAEMATOPOIETIC_AND_LYMPHOID_TISSUE245p.R248Wc.742C>TMissense_Mutation11.99KO52N200N
TP53GMNWRPILTLUNG245p.R248Wc.742C>TMissense_Mutation11.99LUDLU1N200N
TP53GMNWRPILTLUNG245p.R248Wc.742C>TMissense_Mutation11.99LXF289N200N
TP53GMNWRPILTPANCREAS245p.R248Wc.742C>TMissense_Mutation11.99MIAPACA2N200N
TP53GMNWRPILTLUNG245p.R248Wc.741_742CC>TTMissense_Mutation11.99NCIH2106N200N
TP53GMNWRPILTSOFT_TISSUE245p.R248Wc.742C>TMissense_Mutation11.99RDN200N
TP53GMNWRPILTHAEMATOPOIETIC_AND_LYMPHOID_TISSUE245p.R248Wc.742C>TMissense_Mutation11.99SET2N200N
TP53GMNWRPILTLARGE_INTESTINE245p.R248Wc.742C>TMissense_Mutation11.99SNU1040N200N
TP53GMNWRPILTLARGE_INTESTINE245p.R248Wc.742C>TMissense_Mutation11.99SNUC5N200N
TP53GMNWRPILTLARGE_INTESTINE245p.R248Wc.742C>TMissense_Mutation11.99SW837N200N
TP53GMNWRPILTPROSTATE245p.R248Wc.742C>TMissense_Mutation11.99VCAPN200N
TP53GRNSFEVCVTHYROID266p.R273Cc.817C>TMissense_Mutation11.998305CY5100N
TP53GRNSFEVCVCENTRAL_NERVOUS_SYSTEM266p.R273Cc.817C>TMissense_Mutation11.998MGBAY5100N
TP53GRNSFEVCVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE266p.R273Cc.817C>TMissense_Mutation11.99BL70Y5100N
TP53GRNSFEVCVLARGE_INTESTINE266p.R273Cc.817C>TMissense_Mutation11.99CL14Y5100N
TP53GRNSFEVCVOVARY266p.R273Cc.817C>TMissense_Mutation11.99EFO27Y5100N
TP53GRNSFEVCVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE266p.R273Cc.817C>TMissense_Mutation11.99KARPAS299Y5100N
TP53GRNSFEVCVENDOMETRIUM266p.R273Cc.817C>TMissense_Mutation11.99MFE319Y5100N
TP53GRNSFEVCVLUNG266p.R273Cc.817C>TMissense_Mutation11.99NCIH1048Y5100N
TP53GRNSFEVCVPANCREAS266p.R273Cc.817C>TMissense_Mutation11.99PANC0213Y5100N
TP53GRNSFEVCVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE266p.R273Cc.817C>TMissense_Mutation11.99RPMI8402Y5100N
TP53GRNSFEVCVSTOMACH266p.R273Cc.817C>TMissense_Mutation11.99SH10TCY5100N
TP53GRNSFEVCVSOFT_TISSUE266p.R273Cc.817C>TMissense_Mutation11.99SJRH30Y5100N
TP53GRNSFEVCVBILIARY_TRACT266p.R273Cc.817C>TMissense_Mutation11.99SNU1196Y5100N
TP53GRNSFEVCVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE266p.R273Cc.817C>TMissense_Mutation11.99SUDHL4Y5100N
TP53GRNSFEVCVCENTRAL_NERVOUS_SYSTEM266p.R273Cc.817C>TMissense_Mutation11.99SW1088Y5100N
TP53GRNSFEVCVURINARY_TRACT266p.R273Cc.817C>TMissense_Mutation11.99SW1710Y5100N
TP53GRNSFEVCVSTOMACH266p.R273Cc.817C>TMissense_Mutation11.99TGBC11TKBY5100N
TP53GRNSFEVCVTHYROID266p.R273Cc.817C>TMissense_Mutation11.99TT2609C02Y5100N
TP53LGRNSFEVCTHYROID265p.R273Cc.817C>TMissense_Mutation11.998305CN100N
TP53LGRNSFEVCCENTRAL_NERVOUS_SYSTEM265p.R273Cc.817C>TMissense_Mutation11.998MGBAN100N
TP53LGRNSFEVCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE265p.R273Cc.817C>TMissense_Mutation11.99BL70N100N
TP53LGRNSFEVCLARGE_INTESTINE265p.R273Cc.817C>TMissense_Mutation11.99CL14N100N
TP53LGRNSFEVCOVARY265p.R273Cc.817C>TMissense_Mutation11.99EFO27N100N
TP53LGRNSFEVCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE265p.R273Cc.817C>TMissense_Mutation11.99KARPAS299N100N
TP53LGRNSFEVCENDOMETRIUM265p.R273Cc.817C>TMissense_Mutation11.99MFE319N100N
TP53LGRNSFEVCLUNG265p.R273Cc.817C>TMissense_Mutation11.99NCIH1048N100N
TP53LGRNSFEVCPANCREAS265p.R273Cc.817C>TMissense_Mutation11.99PANC0213N100N
TP53LGRNSFEVCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE265p.R273Cc.817C>TMissense_Mutation11.99RPMI8402N100N
TP53LGRNSFEVCSTOMACH265p.R273Cc.817C>TMissense_Mutation11.99SH10TCN100N
TP53LGRNSFEVCSOFT_TISSUE265p.R273Cc.817C>TMissense_Mutation11.99SJRH30N100N
TP53LGRNSFEVCBILIARY_TRACT265p.R273Cc.817C>TMissense_Mutation11.99SNU1196N100N
TP53LGRNSFEVCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE265p.R273Cc.817C>TMissense_Mutation11.99SUDHL4N100N
TP53LGRNSFEVCCENTRAL_NERVOUS_SYSTEM265p.R273Cc.817C>TMissense_Mutation11.99SW1088N100N
TP53LGRNSFEVCURINARY_TRACT265p.R273Cc.817C>TMissense_Mutation11.99SW1710N100N
TP53LGRNSFEVCSTOMACH265p.R273Cc.817C>TMissense_Mutation11.99TGBC11TKBN100N
TP53LGRNSFEVCTHYROID265p.R273Cc.817C>TMissense_Mutation11.99TT2609C02N100N
TP53MGGMNWRPIKIDNEY243p.R248Wc.742C>TMissense_Mutation11.99786ON1000N
TP53MGGMNWRPICENTRAL_NERVOUS_SYSTEM243p.R248Wc.742C>TMissense_Mutation11.99CAS1N1000N
TP53MGGMNWRPILARGE_INTESTINE243p.R248Wc.742C>TMissense_Mutation11.99COLO320N1000N
TP53MGGMNWRPIOESOPHAGUS243p.R248Wc.742C>TMissense_Mutation11.99COLO680NN1000N
TP53MGGMNWRPISOFT_TISSUE243p.R248Wc.741_742CC>TTMissense_Mutation11.99GCTN1000N
TP53MGGMNWRPIBREAST243p.R248Wc.742C>TMissense_Mutation11.99HCC2157N1000N
TP53MGGMNWRPIBREAST243p.R248Wc.742C>TMissense_Mutation11.99JIMT1N1000N
TP53MGGMNWRPIHAEMATOPOIETIC_AND_LYMPHOID_TISSUE243p.R248Wc.742C>TMissense_Mutation11.99KO52N1000N
TP53MGGMNWRPILUNG243p.R248Wc.742C>TMissense_Mutation11.99LUDLU1N1000N
TP53MGGMNWRPILUNG243p.R248Wc.742C>TMissense_Mutation11.99LXF289N1000N
TP53MGGMNWRPIPANCREAS243p.R248Wc.742C>TMissense_Mutation11.99MIAPACA2N1000N
TP53MGGMNWRPILUNG243p.R248Wc.741_742CC>TTMissense_Mutation11.99NCIH2106N1000N
TP53MGGMNWRPISOFT_TISSUE243p.R248Wc.742C>TMissense_Mutation11.99RDN1000N
TP53MGGMNWRPIHAEMATOPOIETIC_AND_LYMPHOID_TISSUE243p.R248Wc.742C>TMissense_Mutation11.99SET2N1000N
TP53MGGMNWRPILARGE_INTESTINE243p.R248Wc.742C>TMissense_Mutation11.99SNU1040N1000N
TP53MGGMNWRPILARGE_INTESTINE243p.R248Wc.742C>TMissense_Mutation11.99SNUC5N1000N
TP53MGGMNWRPILARGE_INTESTINE243p.R248Wc.742C>TMissense_Mutation11.99SW837N1000N
TP53MGGMNWRPIPROSTATE243p.R248Wc.742C>TMissense_Mutation11.99VCAPN1000N
TP53MNWRPILTIKIDNEY246p.R248Wc.742C>TMissense_Mutation11.99786OY101118N
TP53MNWRPILTICENTRAL_NERVOUS_SYSTEM246p.R248Wc.742C>TMissense_Mutation11.99CAS1Y101118N
TP53MNWRPILTILARGE_INTESTINE246p.R248Wc.742C>TMissense_Mutation11.99COLO320Y101118N
TP53MNWRPILTIOESOPHAGUS246p.R248Wc.742C>TMissense_Mutation11.99COLO680NY101118N
TP53MNWRPILTISOFT_TISSUE246p.R248Wc.741_742CC>TTMissense_Mutation11.99GCTY101118N
TP53MNWRPILTIBREAST246p.R248Wc.742C>TMissense_Mutation11.99HCC2157Y101118N
TP53MNWRPILTIBREAST246p.R248Wc.742C>TMissense_Mutation11.99JIMT1Y101118N
TP53MNWRPILTIHAEMATOPOIETIC_AND_LYMPHOID_TISSUE246p.R248Wc.742C>TMissense_Mutation11.99KO52Y101118N
TP53MNWRPILTILUNG246p.R248Wc.742C>TMissense_Mutation11.99LUDLU1Y101118N
TP53MNWRPILTILUNG246p.R248Wc.742C>TMissense_Mutation11.99LXF289Y101118N
TP53MNWRPILTIPANCREAS246p.R248Wc.742C>TMissense_Mutation11.99MIAPACA2Y101118N
TP53MNWRPILTILUNG246p.R248Wc.741_742CC>TTMissense_Mutation11.99NCIH2106Y101118N
TP53MNWRPILTISOFT_TISSUE246p.R248Wc.742C>TMissense_Mutation11.99RDY101118N
TP53MNWRPILTIHAEMATOPOIETIC_AND_LYMPHOID_TISSUE246p.R248Wc.742C>TMissense_Mutation11.99SET2Y101118N
TP53MNWRPILTILARGE_INTESTINE246p.R248Wc.742C>TMissense_Mutation11.99SNU1040Y101118N
TP53MNWRPILTILARGE_INTESTINE246p.R248Wc.742C>TMissense_Mutation11.99SNUC5Y101118N
TP53MNWRPILTILARGE_INTESTINE246p.R248Wc.742C>TMissense_Mutation11.99SW837Y101118N
TP53MNWRPILTIPROSTATE246p.R248Wc.742C>TMissense_Mutation11.99VCAPY101118N
TP53NSFEVCVCATHYROID268p.R273Cc.817C>TMissense_Mutation11.998305CY490N
TP53NSFEVCVCACENTRAL_NERVOUS_SYSTEM268p.R273Cc.817C>TMissense_Mutation11.998MGBAY490N
TP53NSFEVCVCAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE268p.R273Cc.817C>TMissense_Mutation11.99BL70Y490N
TP53NSFEVCVCALARGE_INTESTINE268p.R273Cc.817C>TMissense_Mutation11.99CL14Y490N
TP53NSFEVCVCAOVARY268p.R273Cc.817C>TMissense_Mutation11.99EFO27Y490N
TP53NSFEVCVCAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE268p.R273Cc.817C>TMissense_Mutation11.99KARPAS299Y490N
TP53NSFEVCVCAENDOMETRIUM268p.R273Cc.817C>TMissense_Mutation11.99MFE319Y490N
TP53NSFEVCVCALUNG268p.R273Cc.817C>TMissense_Mutation11.99NCIH1048Y490N
TP53NSFEVCVCAPANCREAS268p.R273Cc.817C>TMissense_Mutation11.99PANC0213Y490N
TP53NSFEVCVCAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE268p.R273Cc.817C>TMissense_Mutation11.99RPMI8402Y490N
TP53NSFEVCVCASTOMACH268p.R273Cc.817C>TMissense_Mutation11.99SH10TCY490N
TP53NSFEVCVCASOFT_TISSUE268p.R273Cc.817C>TMissense_Mutation11.99SJRH30Y490N
TP53NSFEVCVCABILIARY_TRACT268p.R273Cc.817C>TMissense_Mutation11.99SNU1196Y490N
TP53NSFEVCVCAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE268p.R273Cc.817C>TMissense_Mutation11.99SUDHL4Y490N
TP53NSFEVCVCACENTRAL_NERVOUS_SYSTEM268p.R273Cc.817C>TMissense_Mutation11.99SW1088Y490N
TP53NSFEVCVCAURINARY_TRACT268p.R273Cc.817C>TMissense_Mutation11.99SW1710Y490N
TP53NSFEVCVCASTOMACH268p.R273Cc.817C>TMissense_Mutation11.99TGBC11TKBY490N
TP53NSFEVCVCATHYROID268p.R273Cc.817C>TMissense_Mutation11.99TT2609C02Y490N
TP53NWRPILTIIKIDNEY247p.R248Wc.742C>TMissense_Mutation11.99786ON600N
TP53NWRPILTIICENTRAL_NERVOUS_SYSTEM247p.R248Wc.742C>TMissense_Mutation11.99CAS1N600N
TP53NWRPILTIILARGE_INTESTINE247p.R248Wc.742C>TMissense_Mutation11.99COLO320N600N
TP53NWRPILTIIOESOPHAGUS247p.R248Wc.742C>TMissense_Mutation11.99COLO680NN600N
TP53NWRPILTIISOFT_TISSUE247p.R248Wc.741_742CC>TTMissense_Mutation11.99GCTN600N
TP53NWRPILTIIBREAST247p.R248Wc.742C>TMissense_Mutation11.99HCC2157N600N
TP53NWRPILTIIBREAST247p.R248Wc.742C>TMissense_Mutation11.99JIMT1N600N
TP53NWRPILTIIHAEMATOPOIETIC_AND_LYMPHOID_TISSUE247p.R248Wc.742C>TMissense_Mutation11.99KO52N600N
TP53NWRPILTIILUNG247p.R248Wc.742C>TMissense_Mutation11.99LUDLU1N600N
TP53NWRPILTIILUNG247p.R248Wc.742C>TMissense_Mutation11.99LXF289N600N
TP53NWRPILTIIPANCREAS247p.R248Wc.742C>TMissense_Mutation11.99MIAPACA2N600N
TP53NWRPILTIILUNG247p.R248Wc.741_742CC>TTMissense_Mutation11.99NCIH2106N600N
TP53NWRPILTIISOFT_TISSUE247p.R248Wc.742C>TMissense_Mutation11.99RDN600N
TP53NWRPILTIIHAEMATOPOIETIC_AND_LYMPHOID_TISSUE247p.R248Wc.742C>TMissense_Mutation11.99SET2N600N
TP53NWRPILTIILARGE_INTESTINE247p.R248Wc.742C>TMissense_Mutation11.99SNU1040N600N
TP53NWRPILTIILARGE_INTESTINE247p.R248Wc.742C>TMissense_Mutation11.99SNUC5N600N
TP53NWRPILTIILARGE_INTESTINE247p.R248Wc.742C>TMissense_Mutation11.99SW837N600N
TP53NWRPILTIIPROSTATE247p.R248Wc.742C>TMissense_Mutation11.99VCAPN600N
TP53RNSFEVCVCTHYROID267p.R273Cc.817C>TMissense_Mutation11.998305CN000N
TP53RNSFEVCVCCENTRAL_NERVOUS_SYSTEM267p.R273Cc.817C>TMissense_Mutation11.998MGBAN000N
TP53RNSFEVCVCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE267p.R273Cc.817C>TMissense_Mutation11.99BL70N000N
TP53RNSFEVCVCLARGE_INTESTINE267p.R273Cc.817C>TMissense_Mutation11.99CL14N000N
TP53RNSFEVCVCOVARY267p.R273Cc.817C>TMissense_Mutation11.99EFO27N000N
TP53RNSFEVCVCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE267p.R273Cc.817C>TMissense_Mutation11.99KARPAS299N000N
TP53RNSFEVCVCENDOMETRIUM267p.R273Cc.817C>TMissense_Mutation11.99MFE319N000N
TP53RNSFEVCVCLUNG267p.R273Cc.817C>TMissense_Mutation11.99NCIH1048N000N
TP53RNSFEVCVCPANCREAS267p.R273Cc.817C>TMissense_Mutation11.99PANC0213N000N
TP53RNSFEVCVCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE267p.R273Cc.817C>TMissense_Mutation11.99RPMI8402N000N
TP53RNSFEVCVCSTOMACH267p.R273Cc.817C>TMissense_Mutation11.99SH10TCN000N
TP53RNSFEVCVCSOFT_TISSUE267p.R273Cc.817C>TMissense_Mutation11.99SJRH30N000N
TP53RNSFEVCVCBILIARY_TRACT267p.R273Cc.817C>TMissense_Mutation11.99SNU1196N000N
TP53RNSFEVCVCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE267p.R273Cc.817C>TMissense_Mutation11.99SUDHL4N000N
TP53RNSFEVCVCCENTRAL_NERVOUS_SYSTEM267p.R273Cc.817C>TMissense_Mutation11.99SW1088N000N
TP53RNSFEVCVCURINARY_TRACT267p.R273Cc.817C>TMissense_Mutation11.99SW1710N000N
TP53RNSFEVCVCSTOMACH267p.R273Cc.817C>TMissense_Mutation11.99TGBC11TKBN000N
TP53RNSFEVCVCTHYROID267p.R273Cc.817C>TMissense_Mutation11.99TT2609C02N000N
TP53SCMGGMNWRKIDNEY241p.R248Wc.742C>TMissense_Mutation11.99786ON400N
TP53SCMGGMNWRCENTRAL_NERVOUS_SYSTEM241p.R248Wc.742C>TMissense_Mutation11.99CAS1N400N
TP53SCMGGMNWRLARGE_INTESTINE241p.R248Wc.742C>TMissense_Mutation11.99COLO320N400N
TP53SCMGGMNWROESOPHAGUS241p.R248Wc.742C>TMissense_Mutation11.99COLO680NN400N
TP53SCMGGMNWRSOFT_TISSUE241p.R248Wc.741_742CC>TTMissense_Mutation11.99GCTN400N
TP53SCMGGMNWRBREAST241p.R248Wc.742C>TMissense_Mutation11.99HCC2157N400N
TP53SCMGGMNWRBREAST241p.R248Wc.742C>TMissense_Mutation11.99JIMT1N400N
TP53SCMGGMNWRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE241p.R248Wc.742C>TMissense_Mutation11.99KO52N400N
TP53SCMGGMNWRLUNG241p.R248Wc.742C>TMissense_Mutation11.99LUDLU1N400N
TP53SCMGGMNWRLUNG241p.R248Wc.742C>TMissense_Mutation11.99LXF289N400N
TP53SCMGGMNWRPANCREAS241p.R248Wc.742C>TMissense_Mutation11.99MIAPACA2N400N
TP53SCMGGMNWRLUNG241p.R248Wc.741_742CC>TTMissense_Mutation11.99NCIH2106N400N
TP53SCMGGMNWRSOFT_TISSUE241p.R248Wc.742C>TMissense_Mutation11.99RDN400N
TP53SCMGGMNWRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE241p.R248Wc.742C>TMissense_Mutation11.99SET2N400N
TP53SCMGGMNWRLARGE_INTESTINE241p.R248Wc.742C>TMissense_Mutation11.99SNU1040N400N
TP53SCMGGMNWRLARGE_INTESTINE241p.R248Wc.742C>TMissense_Mutation11.99SNUC5N400N
TP53SCMGGMNWRLARGE_INTESTINE241p.R248Wc.742C>TMissense_Mutation11.99SW837N400N
TP53SCMGGMNWRPROSTATE241p.R248Wc.742C>TMissense_Mutation11.99VCAPN400N
TP53SFEVCVCACTHYROID269p.R273Cc.817C>TMissense_Mutation11.998305CN100N
TP53SFEVCVCACCENTRAL_NERVOUS_SYSTEM269p.R273Cc.817C>TMissense_Mutation11.998MGBAN100N
TP53SFEVCVCACHAEMATOPOIETIC_AND_LYMPHOID_TISSUE269p.R273Cc.817C>TMissense_Mutation11.99BL70N100N
TP53SFEVCVCACLARGE_INTESTINE269p.R273Cc.817C>TMissense_Mutation11.99CL14N100N
TP53SFEVCVCACOVARY269p.R273Cc.817C>TMissense_Mutation11.99EFO27N100N
TP53SFEVCVCACHAEMATOPOIETIC_AND_LYMPHOID_TISSUE269p.R273Cc.817C>TMissense_Mutation11.99KARPAS299N100N
TP53SFEVCVCACENDOMETRIUM269p.R273Cc.817C>TMissense_Mutation11.99MFE319N100N
TP53SFEVCVCACLUNG269p.R273Cc.817C>TMissense_Mutation11.99NCIH1048N100N
TP53SFEVCVCACPANCREAS269p.R273Cc.817C>TMissense_Mutation11.99PANC0213N100N
TP53SFEVCVCACHAEMATOPOIETIC_AND_LYMPHOID_TISSUE269p.R273Cc.817C>TMissense_Mutation11.99RPMI8402N100N
TP53SFEVCVCACSTOMACH269p.R273Cc.817C>TMissense_Mutation11.99SH10TCN100N
TP53SFEVCVCACSOFT_TISSUE269p.R273Cc.817C>TMissense_Mutation11.99SJRH30N100N
TP53SFEVCVCACBILIARY_TRACT269p.R273Cc.817C>TMissense_Mutation11.99SNU1196N100N
TP53SFEVCVCACHAEMATOPOIETIC_AND_LYMPHOID_TISSUE269p.R273Cc.817C>TMissense_Mutation11.99SUDHL4N100N
TP53SFEVCVCACCENTRAL_NERVOUS_SYSTEM269p.R273Cc.817C>TMissense_Mutation11.99SW1088N100N
TP53SFEVCVCACURINARY_TRACT269p.R273Cc.817C>TMissense_Mutation11.99SW1710N100N
TP53SFEVCVCACSTOMACH269p.R273Cc.817C>TMissense_Mutation11.99TGBC11TKBN100N
TP53SFEVCVCACTHYROID269p.R273Cc.817C>TMissense_Mutation11.99TT2609C02N100N
TP53SSCMGGMNWKIDNEY240p.R248Wc.742C>TMissense_Mutation11.99786ON300N
TP53SSCMGGMNWCENTRAL_NERVOUS_SYSTEM240p.R248Wc.742C>TMissense_Mutation11.99CAS1N300N
TP53SSCMGGMNWLARGE_INTESTINE240p.R248Wc.742C>TMissense_Mutation11.99COLO320N300N
TP53SSCMGGMNWOESOPHAGUS240p.R248Wc.742C>TMissense_Mutation11.99COLO680NN300N
TP53SSCMGGMNWSOFT_TISSUE240p.R248Wc.741_742CC>TTMissense_Mutation11.99GCTN300N
TP53SSCMGGMNWBREAST240p.R248Wc.742C>TMissense_Mutation11.99HCC2157N300N
TP53SSCMGGMNWBREAST240p.R248Wc.742C>TMissense_Mutation11.99JIMT1N300N
TP53SSCMGGMNWHAEMATOPOIETIC_AND_LYMPHOID_TISSUE240p.R248Wc.742C>TMissense_Mutation11.99KO52N300N
TP53SSCMGGMNWLUNG240p.R248Wc.742C>TMissense_Mutation11.99LUDLU1N300N
TP53SSCMGGMNWLUNG240p.R248Wc.742C>TMissense_Mutation11.99LXF289N300N
TP53SSCMGGMNWPANCREAS240p.R248Wc.742C>TMissense_Mutation11.99MIAPACA2N300N
TP53SSCMGGMNWLUNG240p.R248Wc.741_742CC>TTMissense_Mutation11.99NCIH2106N300N
TP53SSCMGGMNWSOFT_TISSUE240p.R248Wc.742C>TMissense_Mutation11.99RDN300N
TP53SSCMGGMNWHAEMATOPOIETIC_AND_LYMPHOID_TISSUE240p.R248Wc.742C>TMissense_Mutation11.99SET2N300N
TP53SSCMGGMNWLARGE_INTESTINE240p.R248Wc.742C>TMissense_Mutation11.99SNU1040N300N
TP53SSCMGGMNWLARGE_INTESTINE240p.R248Wc.742C>TMissense_Mutation11.99SNUC5N300N
TP53SSCMGGMNWLARGE_INTESTINE240p.R248Wc.742C>TMissense_Mutation11.99SW837N300N
TP53SSCMGGMNWPROSTATE240p.R248Wc.742C>TMissense_Mutation11.99VCAPN300N
TP53VCVCACPGRTHYROID272p.R273Cc.817C>TMissense_Mutation11.998305CN400N
TP53VCVCACPGRCENTRAL_NERVOUS_SYSTEM272p.R273Cc.817C>TMissense_Mutation11.998MGBAN400N
TP53VCVCACPGRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE272p.R273Cc.817C>TMissense_Mutation11.99BL70N400N
TP53VCVCACPGRLARGE_INTESTINE272p.R273Cc.817C>TMissense_Mutation11.99CL14N400N
TP53VCVCACPGROVARY272p.R273Cc.817C>TMissense_Mutation11.99EFO27N400N
TP53VCVCACPGRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE272p.R273Cc.817C>TMissense_Mutation11.99KARPAS299N400N
TP53VCVCACPGRENDOMETRIUM272p.R273Cc.817C>TMissense_Mutation11.99MFE319N400N
TP53VCVCACPGRLUNG272p.R273Cc.817C>TMissense_Mutation11.99NCIH1048N400N
TP53VCVCACPGRPANCREAS272p.R273Cc.817C>TMissense_Mutation11.99PANC0213N400N
TP53VCVCACPGRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE272p.R273Cc.817C>TMissense_Mutation11.99RPMI8402N400N
TP53VCVCACPGRSTOMACH272p.R273Cc.817C>TMissense_Mutation11.99SH10TCN400N
TP53VCVCACPGRSOFT_TISSUE272p.R273Cc.817C>TMissense_Mutation11.99SJRH30N400N
TP53VCVCACPGRBILIARY_TRACT272p.R273Cc.817C>TMissense_Mutation11.99SNU1196N400N
TP53VCVCACPGRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE272p.R273Cc.817C>TMissense_Mutation11.99SUDHL4N400N
TP53VCVCACPGRCENTRAL_NERVOUS_SYSTEM272p.R273Cc.817C>TMissense_Mutation11.99SW1088N400N
TP53VCVCACPGRURINARY_TRACT272p.R273Cc.817C>TMissense_Mutation11.99SW1710N400N
TP53VCVCACPGRSTOMACH272p.R273Cc.817C>TMissense_Mutation11.99TGBC11TKBN400N
TP53VCVCACPGRTHYROID272p.R273Cc.817C>TMissense_Mutation11.99TT2609C02N400N
TP53WRPILTIITKIDNEY248p.R248Wc.742C>TMissense_Mutation11.99786ON4032N
TP53WRPILTIITCENTRAL_NERVOUS_SYSTEM248p.R248Wc.742C>TMissense_Mutation11.99CAS1N4032N
TP53WRPILTIITLARGE_INTESTINE248p.R248Wc.742C>TMissense_Mutation11.99COLO320N4032N
TP53WRPILTIITOESOPHAGUS248p.R248Wc.742C>TMissense_Mutation11.99COLO680NN4032N
TP53WRPILTIITSOFT_TISSUE248p.R248Wc.741_742CC>TTMissense_Mutation11.99GCTN4032N
TP53WRPILTIITBREAST248p.R248Wc.742C>TMissense_Mutation11.99HCC2157N4032N
TP53WRPILTIITBREAST248p.R248Wc.742C>TMissense_Mutation11.99JIMT1N4032N
TP53WRPILTIITHAEMATOPOIETIC_AND_LYMPHOID_TISSUE248p.R248Wc.742C>TMissense_Mutation11.99KO52N4032N
TP53WRPILTIITLUNG248p.R248Wc.742C>TMissense_Mutation11.99LUDLU1N4032N
TP53WRPILTIITLUNG248p.R248Wc.742C>TMissense_Mutation11.99LXF289N4032N
TP53WRPILTIITPANCREAS248p.R248Wc.742C>TMissense_Mutation11.99MIAPACA2N4032N
TP53WRPILTIITLUNG248p.R248Wc.741_742CC>TTMissense_Mutation11.99NCIH2106N4032N
TP53WRPILTIITSOFT_TISSUE248p.R248Wc.742C>TMissense_Mutation11.99RDN4032N
TP53WRPILTIITHAEMATOPOIETIC_AND_LYMPHOID_TISSUE248p.R248Wc.742C>TMissense_Mutation11.99SET2N4032N
TP53WRPILTIITLARGE_INTESTINE248p.R248Wc.742C>TMissense_Mutation11.99SNU1040N4032N
TP53WRPILTIITLARGE_INTESTINE248p.R248Wc.742C>TMissense_Mutation11.99SNUC5N4032N
TP53WRPILTIITLARGE_INTESTINE248p.R248Wc.742C>TMissense_Mutation11.99SW837N4032N
TP53WRPILTIITPROSTATE248p.R248Wc.742C>TMissense_Mutation11.99VCAPN4032N
TP53ACHGRDRRTLARGE_INTESTINE276p.P278Hc.833C>AMissense_Mutation10.11CCK81N100N
TP53ACPGGDRRTSKIN276p.R280Gc.838A>GMissense_Mutation10.11CJMN000N
TP53ACPGKDRRTBREAST276p.R280Kc.839G>AMissense_Mutation10.11MDAMB231N200N
TP53ACPGRDGRTLUNG276p.R282Gc.844C>GMissense_Mutation10.11NCIH510N200N
TP53ACPGRDQRTCENTRAL_NERVOUS_SYSTEM276p.R282Qc.845G>AMissense_Mutation10.1142MGBAN200N
TP53ACPGRNRRTCENTRAL_NERVOUS_SYSTEM276p.D281Nc.841G>AMissense_Mutation10.11SNU201N200N
TP53ACPGRYRRTOVARY276p.D281Yc.841G>TMissense_Mutation10.11KURAMOCHIN300N
TP53ACPGSDRRTSOFT_TISSUE276p.R280Sc.840A>TMissense_Mutation10.11SJRH30N000N
TP53ACRGRDRRTLUNG276p.P278Rc.833C>GMissense_Mutation10.11SCLC21HN100N
TP53ADSSGNLLGSALIVARY_GLAND258p.E258Ac.773A>CMissense_Mutation10.11YD15N100N
TP53AFNKMFCQLLUNG129p.L130Fc.388C>TMissense_Mutation10.11HCC1359Y8100N
TP53AFPGRDRRTLUNG276p.C277Fc.830G>TMissense_Mutation10.11SW1271N200N
TP53AFRHSVVVPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE211p.T211Ac.631A>GMissense_Mutation10.11CI1N000N
TP53AGMNRRPILLIVER244p.G244Ac.731G>CMissense_Mutation10.11HLFN1300N
TP53AIHKQSQHMHAEMATOPOIETIC_AND_LYMPHOID_TISSUE161p.Y163Hc.487T>CMissense_Mutation10.11P3HR1N200N
TP53AIYNQSQHMLUNG161p.K164Nc.492G>TMissense_Mutation10.11NCIH650N300N
TP53AKSVTCTCSOVARY119p.Y126Cc.377A>GMissense_Mutation10.11IGROV1N100N
TP53AKSVTCTYFPANCREAS119p.S127Fc.380C>TMissense_Mutation10.11SNU410N200N
TP53AKSVTCTYPLARGE_INTESTINE119p.S127Pc.379T>CMissense_Mutation10.11CL34N000N
TP53AKTWPVQLWLUNG138p.C141Wc.423C>GMissense_Mutation10.11NCIH1435Y2110N
TP53ALNEMFCQLBREAST129p.K132Ec.394A>GMissense_Mutation10.11CAL851Y18140N
TP53ALNKMCCQLLUNG129p.F134Cc.401T>GMissense_Mutation10.11CORL51Y10100N
TP53ALNKMFFQLLUNG129p.C135Fc.404G>TMissense_Mutation10.11CAL12TY13110N
TP53ALNKMFRQLSKIN129p.C135Rc.403T>CMissense_Mutation10.11COLO818Y11110N
TP53ALNNMFCQLHAEMATOPOIETIC_AND_LYMPHOID_TISSUE129p.K132Nc.396G>CMissense_Mutation10.11EJMY14130N
TP53ALNTMFCQLLARGE_INTESTINE129p.K132Tc.395A>CMissense_Mutation10.11SNU81Y13100N
TP53ALPQHLIRVLARGE_INTESTINE189p.P190Lc.569C>TMissense_Mutation10.11SNU1033Y890N
TP53AMAIHKQSQHAEMATOPOIETIC_AND_LYMPHOID_TISSUE159p.Y163Hc.487T>CMissense_Mutation10.11P3HR1N000N
TP53AMAIYNQSQLUNG159p.K164Nc.492G>TMissense_Mutation10.11NCIH650N100N
TP53AMANYKQSQURINARY_TRACT159p.I162Nc.485T>AMissense_Mutation10.11647VN100N
TP53ANYKQSQHMURINARY_TRACT161p.I162Nc.485T>AMissense_Mutation10.11647VN400N
TP53APPGTRVRAOVARY151p.P151Ac.451C>GMissense_Mutation10.11SNU119Y9100N
TP53APPQHFIRVBREAST189p.L194Fc.580C>TMissense_Mutation10.11T47DY1490N
TP53APPQHLFRVOVARY189p.I195Fc.583A>TMissense_Mutation10.11COV318N1500N
TP53APPQHLIPVLARGE_INTESTINE189p.R196Pc.587G>CMissense_Mutation10.11HCC56Y1490N
TP53APPQHLSRVENDOMETRIUM189p.I195Sc.584T>GMissense_Mutation10.11SNU1077N1400N
TP53APPQHRIRVSTOMACH189p.L194Rc.581T>GMissense_Mutation10.11GSSY1390N
TP53APPQLLIRVUPPER_AERODIGESTIVE_TRACT189p.H193Lc.578A>TMissense_Mutation10.11CAL27Y1590N
TP53APPQPLIRVSTOMACH189p.H193Pc.578A>CMissense_Mutation10.11HUG1NY1390N
TP53APPQYLIRVCENTRAL_NERVOUS_SYSTEM189p.H193Yc.577C>TMissense_Mutation10.11KNS60Y1490N
TP53AVNKMFCQLOVARY129p.L130Vc.388C>GMissense_Mutation10.11OVCAR4Y10100N
TP53CACHGRDRRLARGE_INTESTINE275p.P278Hc.833C>AMissense_Mutation10.11CCK81N300N
TP53CACPGGDRRSKIN275p.R280Gc.838A>GMissense_Mutation10.11CJMN300N
TP53CACPGKDRRBREAST275p.R280Kc.839G>AMissense_Mutation10.11MDAMB231N300N
TP53CACPGRDGRLUNG275p.R282Gc.844C>GMissense_Mutation10.11NCIH510N300N
TP53CACPGRDQRCENTRAL_NERVOUS_SYSTEM275p.R282Qc.845G>AMissense_Mutation10.1142MGBAN300N
TP53CACPGRNRRCENTRAL_NERVOUS_SYSTEM275p.D281Nc.841G>AMissense_Mutation10.11SNU201Y390N
TP53CACPGRYRROVARY275p.D281Yc.841G>TMissense_Mutation10.11KURAMOCHIY490N
TP53CACPGSDRRSOFT_TISSUE275p.R280Sc.840A>TMissense_Mutation10.11SJRH30N300N
TP53CACRGRDRRLUNG275p.P278Rc.833C>GMissense_Mutation10.11SCLC21HN300N
TP53CAFPGRDRRLUNG275p.C277Fc.830G>TMissense_Mutation10.11SW1271Y590N
TP53CCQLAKTCPLUNG134p.F134Cc.401T>GMissense_Mutation10.11CORL51N000N
TP53CCSDSDGLAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE181p.R181Cc.541C>TMissense_Mutation10.11CMLT1N000N
TP53CFEMFRELNOESOPHAGUS337p.R337Cc.1009C>TMissense_Mutation10.11KYSE410N000Y
TP53CGMNRRPILLUNG244p.G244Cc.730G>TMissense_Mutation10.11NCIH1836N1300N
TP53CHGRDRRTELARGE_INTESTINE277p.P278Hc.833C>AMissense_Mutation10.11CCK81N000N
TP53CKKGEPHHEHAEMATOPOIETIC_AND_LYMPHOID_TISSUE290p.R290Cc.868C>TMissense_Mutation10.11CMLT1N000N
TP53CLDDRNTFRSOFT_TISSUE205p.Y205Cc.614A>GMissense_Mutation10.11SJRH30N600N
TP53CMAGMNRRPLIVER242p.G244Ac.731G>CMissense_Mutation10.11HLFN000N
TP53CMCGMNRRPLUNG242p.G244Cc.730G>TMissense_Mutation10.11NCIH1836N000N
TP53CMDGMNRRPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE242p.G244Dc.731G>AMissense_Mutation10.11EB2N000Y
TP53CMGGMIRRPLUNG242p.N247Ic.740A>TMissense_Mutation10.11HCC1171N000N
TP53CMGGMNGRPTHYROID242p.R248Gc.742C>GMissense_Mutation10.118505CN000N
TP53CMGGMNRRLURINARY_TRACT242p.P250Lc.749C>TMissense_Mutation10.11HT1376N600N
TP53CMGGRNRRPAUTONOMIC_GANGLIA242p.M246Rc.737T>GMissense_Mutation10.11SKNFIN000N
TP53CMGGVNRRPENDOMETRIUM242p.M246Vc.736A>GMissense_Mutation10.11ISHIKAWAHERAKLIO02ERN000Y
TP53CMGRMNRRPLUNG242p.G245Rc.733G>CMissense_Mutation10.11NCIH1930N000N
TP53CMGVMNRRPLUNG242p.G245Vc.734G>TMissense_Mutation10.11CPCNN000N
TP53CNRSCMGGMLUNG238p.S240Rc.720T>AMissense_Mutation10.11NCIH2023N200N
TP53CNSSCMAGMLIVER238p.G244Ac.731G>CMissense_Mutation10.11HLFN100N
TP53CNSSCMCGMLUNG238p.G244Cc.730G>TMissense_Mutation10.11NCIH1836N100N
TP53CNSSCMDGMHAEMATOPOIETIC_AND_LYMPHOID_TISSUE238p.G244Dc.731G>AMissense_Mutation10.11EB2N200N
TP53CNSSCMGGRAUTONOMIC_GANGLIA238p.M246Rc.737T>GMissense_Mutation10.11SKNFIN200N
TP53CNSSCMGGVENDOMETRIUM238p.M246Vc.736A>GMissense_Mutation10.11ISHIKAWAHERAKLIO02ERN000N
TP53CNSSCMGRMLUNG238p.G245Rc.733G>CMissense_Mutation10.11NCIH1930Y1140N
TP53CNSSCMGVMLUNG238p.G245Vc.734G>TMissense_Mutation10.11CPCNN100N
TP53CNSSFMGGMCENTRAL_NERVOUS_SYSTEM238p.C242Fc.725G>TMissense_Mutation10.11DAOYN100N
TP53CNSSRMGGMPANCREAS238p.C242Rc.724T>CMissense_Mutation10.11CFPAC1N200N
TP53CNSSWMGGMLUNG238p.C242Wc.726C>GMissense_Mutation10.11NCIH2073N100N
TP53CNSYCMGGMENDOMETRIUM238p.S241Yc.722C>AMissense_Mutation10.11HEC251N100N
TP53CPGGDRRTESKIN277p.R280Gc.838A>GMissense_Mutation10.11CJMN000N
TP53CPGKDRRTEBREAST277p.R280Kc.839G>AMissense_Mutation10.11MDAMB231N000N
TP53CPGRDGRTELUNG277p.R282Gc.844C>GMissense_Mutation10.11NCIH510N000N
TP53CPGRDQRTECENTRAL_NERVOUS_SYSTEM277p.R282Qc.845G>AMissense_Mutation10.1142MGBAN000N
TP53CPGRNRRTECENTRAL_NERVOUS_SYSTEM277p.D281Nc.841G>AMissense_Mutation10.11SNU201N000N
TP53CPGRYRRTEOVARY277p.D281Yc.841G>TMissense_Mutation10.11KURAMOCHIN000N
TP53CPGSDRRTESOFT_TISSUE277p.R280Sc.840A>TMissense_Mutation10.11SJRH30N000N
TP53CPHDERCSDOVARY176p.H179Dc.535C>GMissense_Mutation10.11FUOV1N100N
TP53CPHHECCSDHAEMATOPOIETIC_AND_LYMPHOID_TISSUE176p.R181Cc.541C>TMissense_Mutation10.11CMLT1N000N
TP53CQLAKTWPVLUNG135p.C141Wc.423C>GMissense_Mutation10.11NCIH1435Y990N
TP53CQLPKTCPVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE135p.A138Pc.412G>CMissense_Mutation10.11RLY9110N
TP53CRGRDRRTELUNG277p.P278Rc.833C>GMissense_Mutation10.11SCLC21HN000N
TP53CSPALNKMFOVARY126p.Y126Cc.377A>GMissense_Mutation10.11IGROV1N800N
TP53CSSSCMGGMHAEMATOPOIETIC_AND_LYMPHOID_TISSUE238p.N239Sc.716A>GMissense_Mutation10.11PF382N400N
TP53CTCSPALNKOVARY124p.Y126Cc.377A>GMissense_Mutation10.11IGROV1Y4110N
TP53CTHHERCSDAUTONOMIC_GANGLIA176p.P177Tc.529C>AMissense_Mutation10.11KELLYN000N
TP53CTTIHDNYMHAEMATOPOIETIC_AND_LYMPHOID_TISSUE229p.Y234Dc.700T>GMissense_Mutation10.11KASUMI6N200N
TP53CTTIHHNYMHAEMATOPOIETIC_AND_LYMPHOID_TISSUE229p.Y234Hc.700T>CMissense_Mutation10.11RAJIN200N
TP53CTTIHNNYMHAEMATOPOIETIC_AND_LYMPHOID_TISSUE229p.Y234Nc.700T>AMissense_Mutation10.11SUDHL8N200Y
TP53CTTIHYNYKSOFT_TISSUE229p.M237Kc.710T>AMissense_Mutation10.11SKLMS1Y1130N
TP53CTYFPALNKPANCREAS124p.S127Fc.380C>TMissense_Mutation10.11SNU410Y6130Y
TP53CTYPPALNKLARGE_INTESTINE124p.S127Pc.379T>CMissense_Mutation10.11CL34Y6120N
TP53CTYSPAFNKLUNG124p.L130Fc.388C>TMissense_Mutation10.11HCC1359N600Y
TP53CTYSPALNEBREAST124p.K132Ec.394A>GMissense_Mutation10.11CAL851N000N
TP53CTYSPALNNHAEMATOPOIETIC_AND_LYMPHOID_TISSUE124p.K132Nc.396G>CMissense_Mutation10.11EJMN000N
TP53CTYSPALNTLARGE_INTESTINE124p.K132Tc.395A>CMissense_Mutation10.11SNU81N100N
TP53CTYSPAVNKOVARY124p.L130Vc.388C>GMissense_Mutation10.11OVCAR4N500N
TP53CVVVPYEPPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE215p.S215Cc.643A>TMissense_Mutation10.11DELN000N
TP53DCTTIHDNYHAEMATOPOIETIC_AND_LYMPHOID_TISSUE228p.Y234Dc.700T>GMissense_Mutation10.11KASUMI6N400N
TP53DCTTIHHNYHAEMATOPOIETIC_AND_LYMPHOID_TISSUE228p.Y234Hc.700T>CMissense_Mutation10.11RAJIN400N
TP53DCTTIHNNYHAEMATOPOIETIC_AND_LYMPHOID_TISSUE228p.Y234Nc.700T>AMissense_Mutation10.11SUDHL8N400Y
TP53DDRNAFRHSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE207p.T211Ac.631A>GMissense_Mutation10.11CI1N200N
TP53DDRNIFRHSCENTRAL_NERVOUS_SYSTEM207p.T211Ic.632C>TMissense_Mutation10.1142MGBAN300N
TP53DDRNTFRHCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE207p.S215Cc.643A>TMissense_Mutation10.11DELN200N
TP53DDRNTFRHROVARY207p.S215Rc.643A>CMissense_Mutation10.11OV90N000N
TP53DERCSDSDGOVARY179p.H179Dc.535C>GMissense_Mutation10.11FUOV1N000N
TP53DGEYFTLRIPROSTATE324p.Q331Rc.992A>GMissense_Mutation10.1122RV1N700N
TP53DGKYFTLQIOESOPHAGUS324p.E326Kc.976G>AMissense_Mutation10.11KYSE30N600Y
TP53DGLALPQHLLARGE_INTESTINE186p.P190Lc.569C>TMissense_Mutation10.11SNU1033N1300Y
TP53DGLAPPQHFBREAST186p.L194Fc.580C>TMissense_Mutation10.11T47DN400Y
TP53DGLAPPQHRSTOMACH186p.L194Rc.581T>GMissense_Mutation10.11GSSN100Y
TP53DGLAPPQLLUPPER_AERODIGESTIVE_TRACT186p.H193Lc.578A>TMissense_Mutation10.11CAL27N1400Y
TP53DGLAPPQPLSTOMACH186p.H193Pc.578A>CMissense_Mutation10.11HUG1NN1300Y
TP53DGLAPPQYLCENTRAL_NERVOUS_SYSTEM186p.H193Yc.577C>TMissense_Mutation10.11KNS60N1300Y
TP53DGMNRRPILHAEMATOPOIETIC_AND_LYMPHOID_TISSUE244p.G244Dc.731G>AMissense_Mutation10.11EB2N1200Y
TP53DGRTEEENLLUNG281p.R282Gc.844C>GMissense_Mutation10.11NCIH510N700N
TP53DLWKLLLENSKIN21p.P27Lc.80C>TMissense_Mutation10.11COLO783N000N
TP53DNLLGRNSFLIVER262p.G262Dc.785G>AMissense_Mutation10.11SNU475N300N
TP53DNYMCNSSCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE234p.Y234Dc.700T>GMissense_Mutation10.11KASUMI6N000N
TP53DQRTEEENLCENTRAL_NERVOUS_SYSTEM281p.R282Qc.845G>AMissense_Mutation10.1142MGBAY6120N
TP53DRNAFRHSVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE208p.T211Ac.631A>GMissense_Mutation10.11CI1Y3110N
TP53DRNIFRHSVCENTRAL_NERVOUS_SYSTEM208p.T211Ic.632C>TMissense_Mutation10.1142MGBAY390N
TP53DRNTFRHCVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE208p.S215Cc.643A>TMissense_Mutation10.11DELY490N
TP53DRNTFRHRVOVARY208p.S215Rc.643A>CMissense_Mutation10.11OV90Y4100N
TP53DRNTFRHSLLUNG208p.V216Lc.646G>TMissense_Mutation10.11LCLC103HY790N
TP53DSDGLALPQLARGE_INTESTINE184p.P190Lc.569C>TMissense_Mutation10.11SNU1033N200N
TP53DSSDNLLGRLIVER259p.G262Dc.785G>AMissense_Mutation10.11SNU475Y4100N
TP53DSSGNLLGWSKIN259p.R267Wc.799C>TMissense_Mutation10.11SKMEL3N400N
TP53DSSGNLLRRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE259p.G266Rc.796G>CMissense_Mutation10.11NCO2Y4100N
TP53DSSGNLPGRCENTRAL_NERVOUS_SYSTEM259p.L265Pc.794T>CMissense_Mutation10.11GAMGN300N
TP53DSSVNLLGRLUNG259p.G262Vc.785G>TMissense_Mutation10.11NCIH2030N400N
TP53DSTAPPGTROVARY148p.P151Ac.451C>GMissense_Mutation10.11SNU119N300N
TP53DSTGNLLGRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE259p.S261Tc.782G>CMissense_Mutation10.11L363N400N
TP53DSTHPPGTRENDOMETRIUM148p.P151Hc.452C>AMissense_Mutation10.11HEC108N300N
TP53DSTPLPGTRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE148p.P152Lc.455C>TMissense_Mutation10.11SR786N400N
TP53DSTPPPGNRLUNG148p.T155Nc.464C>AMissense_Mutation10.11NCIH524N400N
TP53DSTPPPGPRLUNG148p.T155Pc.463A>CMissense_Mutation10.11DMS153N400N
TP53DSTPSPGTRURINARY_TRACT148p.P152Sc.454C>TMissense_Mutation10.11UMUC1N400N
TP53ECCSDSDGLHAEMATOPOIETIC_AND_LYMPHOID_TISSUE180p.R181Cc.541C>TMissense_Mutation10.11CMLT1N300N
TP53ECFEMFRELOESOPHAGUS336p.R337Cc.1009C>TMissense_Mutation10.11KYSE410Y1590Y
TP53ECLDDRNTFSOFT_TISSUE204p.Y205Cc.614A>GMissense_Mutation10.11SJRH30N500N
TP53EDSSDNLLGLIVER258p.G262Dc.785G>AMissense_Mutation10.11SNU475N100N
TP53EDSSGNLLRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE258p.G266Rc.796G>CMissense_Mutation10.11NCO2N100N
TP53EDSSGNLPGCENTRAL_NERVOUS_SYSTEM258p.L265Pc.794T>CMissense_Mutation10.11GAMGN000N
TP53EDSSVNLLGLUNG258p.G262Vc.785G>TMissense_Mutation10.11NCIH2030N100N
TP53EDSTGNLLGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE258p.S261Tc.782G>CMissense_Mutation10.11L363N100N
TP53EEENLCKKGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE285p.R290Cc.868C>TMissense_Mutation10.11CMLT1N000N
TP53EEENLREKGSOFT_TISSUE285p.K291Ec.871A>GMissense_Mutation10.11TE125TN000N
TP53EENLCKKGEHAEMATOPOIETIC_AND_LYMPHOID_TISSUE286p.R290Cc.868C>TMissense_Mutation10.11CMLT1N000N
TP53EENLREKGESOFT_TISSUE286p.K291Ec.871A>GMissense_Mutation10.11TE125TN000N
TP53EGNLRLEYLBONE198p.V203Lc.607G>TMissense_Mutation10.11SW1353Y10110N
TP53EGNLRVECLSOFT_TISSUE198p.Y205Cc.614A>GMissense_Mutation10.11SJRH30Y10100N
TP53EKGEPHHELSOFT_TISSUE291p.K291Ec.871A>GMissense_Mutation10.11TE125TN300N
TP53ELNEVLELKOVARY343p.A347Vc.1040C>TMissense_Mutation10.11RMUGSY3170N
TP53EMFCQLAKTBREAST132p.K132Ec.394A>GMissense_Mutation10.11CAL851N300N
TP53EMFRELNEVOVARY339p.A347Vc.1040C>TMissense_Mutation10.11RMUGSN800Y
TP53ENLCKKGEPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE287p.R290Cc.868C>TMissense_Mutation10.11CMLT1N000N
TP53ENLREKGEPSOFT_TISSUE287p.K291Ec.871A>GMissense_Mutation10.11TE125TN000N
TP53ENSSGNLLGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE258p.D259Nc.775G>AMissense_Mutation10.11BCP1N000N
TP53EPPKVGSDCBREAST221p.E224Kc.670G>AMissense_Mutation10.11CAL148N400Y
TP53EPPLSLETFLUNG11p.Q16Lc.47A>TMissense_Mutation10.11NCIH2122N1400Y
TP53EPYHELPPGURINARY_TRACT294p.H296Yc.886C>TMissense_Mutation10.11UBLC1N100Y
TP53EVLELKDAQOVARY346p.A347Vc.1040C>TMissense_Mutation10.11RMUGSN100N
TP53EVMRRCPHHHAEMATOPOIETIC_AND_LYMPHOID_TISSUE171p.V173Mc.517G>AMissense_Mutation10.11MOLM16N200N
TP53EVRVCACHGLARGE_INTESTINE271p.P278Hc.833C>AMissense_Mutation10.11CCK81N000N
TP53EVRVCACRGLUNG271p.P278Rc.833C>GMissense_Mutation10.11SCLC21HN000N
TP53EVRVCAFPGLUNG271p.C277Fc.830G>TMissense_Mutation10.11SW1271N000N
TP53EVRVYACPGCENTRAL_NERVOUS_SYSTEM271p.C275Yc.824G>AMissense_Mutation10.11GI1N000N
TP53EVSSGNLLGLUNG258p.D259Vc.776A>TMissense_Mutation10.11HCC15N000N
TP53EVVRLCPHHLUNG171p.R175Lc.524G>TMissense_Mutation10.11HCC44N200N
TP53EVVRRCPHDOVARY171p.H179Dc.535C>GMissense_Mutation10.11FUOV1N000N
TP53EVVRRCTHHAUTONOMIC_GANGLIA171p.P177Tc.529C>AMissense_Mutation10.11KELLYN200N
TP53EVVRRSPHHPANCREAS171p.C176Sc.526T>AMissense_Mutation10.11PATU8902N200N
TP53EVVRRYPHHLUNG171p.C176Yc.527G>AMissense_Mutation10.11NCIH1651N200N
TP53EYFTLQIRVLUNG326p.G334Vc.1001G>TMissense_Mutation10.11NCIH1184Y11100N
TP53EYFTLRIRGPROSTATE326p.Q331Rc.992A>GMissense_Mutation10.1122RV1N000N
TP53EYLDDRNAFHAEMATOPOIETIC_AND_LYMPHOID_TISSUE204p.T211Ac.631A>GMissense_Mutation10.11CI1Y590N
TP53EYLDDRNIFCENTRAL_NERVOUS_SYSTEM204p.T211Ic.632C>TMissense_Mutation10.1142MGBAY690N
TP53FCQLAKTWPLUNG134p.C141Wc.423C>GMissense_Mutation10.11NCIH1435N200N
TP53FCQLPKTCPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE134p.A138Pc.412G>CMissense_Mutation10.11RLN200N
TP53FEVRVCACHLARGE_INTESTINE270p.P278Hc.833C>AMissense_Mutation10.11CCK81N306N
TP53FEVRVCACRLUNG270p.P278Rc.833C>GMissense_Mutation10.11SCLC21HN303N
TP53FEVRVCAFPLUNG270p.C277Fc.830G>TMissense_Mutation10.11SW1271N302N
TP53FEVRVYACPCENTRAL_NERVOUS_SYSTEM270p.C275Yc.824G>AMissense_Mutation10.11GI1N300N
TP53FFQLAKTCPLUNG134p.C135Fc.404G>TMissense_Mutation10.11CAL12TN201N
TP53FIRVEGNLRBREAST194p.L194Fc.580C>TMissense_Mutation10.11T47DN503N
TP53FLLGFLHSGURINARY_TRACT109p.R110Lc.329G>TMissense_Mutation10.11SCABERN400N
TP53FMGGMNRRPCENTRAL_NERVOUS_SYSTEM242p.C242Fc.725G>TMissense_Mutation10.11DAOYN100N
TP53FNKMFCQLALUNG130p.L130Fc.388C>TMissense_Mutation10.11HCC1359N3011N
TP53FPALNKMFCPANCREAS127p.S127Fc.380C>TMissense_Mutation10.11SNU410N9012Y
TP53FPGRDRRTELUNG277p.C277Fc.830G>TMissense_Mutation10.11SW1271N303N
TP53FQLAKTCPVLUNG135p.C135Fc.404G>TMissense_Mutation10.11CAL12TN13027N
TP53FRELNEVLEOVARY341p.A347Vc.1040C>TMissense_Mutation10.11RMUGSN300N
TP53FRHCVVVPYHAEMATOPOIETIC_AND_LYMPHOID_TISSUE212p.S215Cc.643A>TMissense_Mutation10.11DELN7029N
TP53FRHRVVVPYOVARY212p.S215Rc.643A>CMissense_Mutation10.11OV90N7024N
TP53FRHSLVVPYLUNG212p.V216Lc.646G>TMissense_Mutation10.11LCLC103HN8025N
TP53FRHSVGVPYBILIARY_TRACT212p.V217Gc.650T>GMissense_Mutation10.11SNU308N707N
TP53FRHSVVLPYLARGE_INTESTINE212p.V218Lc.652G>TMissense_Mutation10.11SNUC5N7036N
TP53FRQLAKTCPSKIN134p.C135Rc.403T>CMissense_Mutation10.11COLO818N3012N
TP53FRVEGNLRVOVARY195p.I195Fc.583A>TMissense_Mutation10.11COV318Y81115N
TP53FSDLWKLLLSKIN19p.P27Lc.80C>TMissense_Mutation10.11COLO783N1104N
TP53FTLQIRVRELUNG328p.G334Vc.1001G>TMissense_Mutation10.11NCIH1184N204N
TP53FTLRIRGREPROSTATE328p.Q331Rc.992A>GMissense_Mutation10.1122RV1N205N
TP53GDRRTEEENSKIN280p.R280Gc.838A>GMissense_Mutation10.11CJMN100N
TP53GEPYHELPPURINARY_TRACT293p.H296Yc.886C>TMissense_Mutation10.11UBLC1N000Y
TP53GEYFTLRIRPROSTATE325p.Q331Rc.992A>GMissense_Mutation10.1122RV1Y290N
TP53GFLLGFLHSURINARY_TRACT108p.R110Lc.329G>TMissense_Mutation10.11SCABERN000N
TP53GGDRRTEEESKIN279p.R280Gc.838A>GMissense_Mutation10.11CJMN000N
TP53GGMIRRPILLUNG244p.N247Ic.740A>TMissense_Mutation10.11HCC1171Y13100Y
TP53GGMNGRPILTHYROID244p.R248Gc.742C>GMissense_Mutation10.118505CN1300Y
TP53GGMNRRLILURINARY_TRACT244p.P250Lc.749C>TMissense_Mutation10.11HT1376N1300N
TP53GGMNRRPIPLUNG244p.L252Pc.755T>CMissense_Mutation10.11CORL51N000Y
TP53GGMNRRPLLSTOMACH244p.I251Lc.751A>CMissense_Mutation10.11MKN74N1300N
TP53GGMNRRPNLLIVER244p.I251Nc.752T>AMissense_Mutation10.11SNU878N1200N
TP53GGRNRRPILAUTONOMIC_GANGLIA244p.M246Rc.737T>GMissense_Mutation10.11SKNFIY1090Y
TP53GGVNRRPILENDOMETRIUM244p.M246Vc.736A>GMissense_Mutation10.11ISHIKAWAHERAKLIO02ERY1390Y
TP53GKDRRTEEEBREAST279p.R280Kc.839G>AMissense_Mutation10.11MDAMB231N000N
TP53GKYFTLQIROESOPHAGUS325p.E326Kc.976G>AMissense_Mutation10.11KYSE30N100Y
TP53GLALPQHLILARGE_INTESTINE187p.P190Lc.569C>TMissense_Mutation10.11SNU1033N600Y
TP53GLAPPQHFIBREAST187p.L194Fc.580C>TMissense_Mutation10.11T47DY7140N
TP53GLAPPQHLFOVARY187p.I195Fc.583A>TMissense_Mutation10.11COV318Y4110Y
TP53GLAPPQHLSENDOMETRIUM187p.I195Sc.584T>GMissense_Mutation10.11SNU1077N000Y
TP53GLAPPQHRISTOMACH187p.L194Rc.581T>GMissense_Mutation10.11GSSY7130Y
TP53GLAPPQLLIUPPER_AERODIGESTIVE_TRACT187p.H193Lc.578A>TMissense_Mutation10.11CAL27Y7140N
TP53GLAPPQPLISTOMACH187p.H193Pc.578A>CMissense_Mutation10.11HUG1NY7130N
TP53GLAPPQYLICENTRAL_NERVOUS_SYSTEM187p.H193Yc.577C>TMissense_Mutation10.11KNS60Y7150N
TP53GMIRRPILTLUNG245p.N247Ic.740A>TMissense_Mutation10.11HCC1171N200Y
TP53GMNGRPILTTHYROID245p.R248Gc.742C>GMissense_Mutation10.118505CN200N
TP53GMNRRLILTURINARY_TRACT245p.P250Lc.749C>TMissense_Mutation10.11HT1376N300N
TP53GMNRRPIPTLUNG245p.L252Pc.755T>CMissense_Mutation10.11CORL51N200N
TP53GMNRRPLLTSTOMACH245p.I251Lc.751A>CMissense_Mutation10.11MKN74N200N
TP53GMNRRPNLTLIVER245p.I251Nc.752T>AMissense_Mutation10.11SNU878N100N
TP53GNLLGWNSFSKIN262p.R267Wc.799C>TMissense_Mutation10.11SKMEL3N400N
TP53GNLLRRNSFHAEMATOPOIETIC_AND_LYMPHOID_TISSUE262p.G266Rc.796G>CMissense_Mutation10.11NCO2Y4120N
TP53GNLPGRNSFCENTRAL_NERVOUS_SYSTEM262p.L265Pc.794T>CMissense_Mutation10.11GAMGY5120N
TP53GNLRLEYLDBONE199p.V203Lc.607G>TMissense_Mutation10.11SW1353N000N
TP53GNLRVECLDSOFT_TISSUE199p.Y205Cc.614A>GMissense_Mutation10.11SJRH30N000N
TP53GNRVRAMAILUNG154p.T155Nc.464C>AMissense_Mutation10.11NCIH524Y6120N
TP53GNSSCMGGMCENTRAL_NERVOUS_SYSTEM238p.C238Gc.712T>GMissense_Mutation10.11TM31N100N
TP53GPRVRAMAILUNG154p.T155Pc.463A>CMissense_Mutation10.11DMS153Y14110N
TP53GRDGRTEEELUNG279p.R282Gc.844C>GMissense_Mutation10.11NCIH510N100N
TP53GRDQRTEEECENTRAL_NERVOUS_SYSTEM279p.R282Qc.845G>AMissense_Mutation10.1142MGBAN100N
TP53GRECFEMFROESOPHAGUS334p.R337Cc.1009C>TMissense_Mutation10.11KYSE410Y490Y
TP53GRMNRRPILLUNG244p.G245Rc.733G>CMissense_Mutation10.11NCIH1930Y6110N
TP53GRNRRPILTAUTONOMIC_GANGLIA245p.M246Rc.737T>GMissense_Mutation10.11SKNFIN300N
TP53GRNRRTEEECENTRAL_NERVOUS_SYSTEM279p.D281Nc.841G>AMissense_Mutation10.11SNU201N100N
TP53GRPILTIITTHYROID248p.R248Gc.742C>GMissense_Mutation10.118505CN200N
TP53GRTEEENLRLUNG282p.R282Gc.844C>GMissense_Mutation10.11NCIH510N300N
TP53GRYRRTEEEOVARY279p.D281Yc.841G>TMissense_Mutation10.11KURAMOCHIN300N
TP53GSDCTTIHDHAEMATOPOIETIC_AND_LYMPHOID_TISSUE226p.Y234Dc.700T>GMissense_Mutation10.11KASUMI6N000Y
TP53GSDCTTIHHHAEMATOPOIETIC_AND_LYMPHOID_TISSUE226p.Y234Hc.700T>CMissense_Mutation10.11RAJIN100Y
TP53GSDCTTIHNHAEMATOPOIETIC_AND_LYMPHOID_TISSUE226p.Y234Nc.700T>AMissense_Mutation10.11SUDHL8N100Y
TP53GSDRRTEEESOFT_TISSUE279p.R280Sc.840A>TMissense_Mutation10.11SJRH30N000N
TP53GSYGFLLGFURINARY_TRACT105p.R110Lc.329G>TMissense_Mutation10.11SCABERN1200N
TP53GTRVPAMAILUNG154p.R158Pc.473G>CMissense_Mutation10.11NCIH2110Y4130N
TP53GTRVRAMANURINARY_TRACT154p.I162Nc.485T>AMissense_Mutation10.11647VN100N
TP53GTRVRPMAIUPPER_AERODIGESTIVE_TRACT154p.A159Pc.475G>CMissense_Mutation10.11SNU1214Y7130N
TP53GVMNRRPILLUNG244p.G245Vc.734G>TMissense_Mutation10.11CPCNN900N
TP53GVNRRPILTENDOMETRIUM245p.M246Vc.736A>GMissense_Mutation10.11ISHIKAWAHERAKLIO02ERN100Y
TP53GVPYEPPEVBILIARY_TRACT217p.V217Gc.650T>GMissense_Mutation10.11SNU308N300N
TP53GWNSFEVRVSKIN266p.R267Wc.799C>TMissense_Mutation10.11SKMEL3Y2120N
TP53HCVVVPYEPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE214p.S215Cc.643A>TMissense_Mutation10.11DELN000N
TP53HDERCSDSDOVARY178p.H179Dc.535C>GMissense_Mutation10.11FUOV1N000N
TP53HDNYMCNSSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE233p.Y234Dc.700T>GMissense_Mutation10.11KASUMI6N100N
TP53HECCSDSDGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE179p.R181Cc.541C>TMissense_Mutation10.11CMLT1N000N
TP53HFIRVEGNLBREAST193p.L194Fc.580C>TMissense_Mutation10.11T47DY8150N
TP53HGRDRRTEELARGE_INTESTINE278p.P278Hc.833C>AMissense_Mutation10.11CCK81N100N
TP53HHECCSDSDHAEMATOPOIETIC_AND_LYMPHOID_TISSUE178p.R181Cc.541C>TMissense_Mutation10.11CMLT1N000N
TP53HHNYMCNSSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE233p.Y234Hc.700T>CMissense_Mutation10.11RAJIN100N
TP53HKQSQHMTEHAEMATOPOIETIC_AND_LYMPHOID_TISSUE163p.Y163Hc.487T>CMissense_Mutation10.11P3HR1N000N
TP53HLFRVEGNLOVARY193p.I195Fc.583A>TMissense_Mutation10.11COV318N1300N
TP53HLIPVEGNLLARGE_INTESTINE193p.R196Pc.587G>CMissense_Mutation10.11HCC56Y11140N
TP53HLSRVEGNLENDOMETRIUM193p.I195Sc.584T>GMissense_Mutation10.11SNU1077Y8160N
TP53HMTEVMRRCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE168p.V173Mc.517G>AMissense_Mutation10.11MOLM16Y090N
TP53HMTEVVRLCLUNG168p.R175Lc.524G>TMissense_Mutation10.11HCC44Y090N
TP53HMTEVVRRSPANCREAS168p.C176Sc.526T>AMissense_Mutation10.11PATU8902N000N
TP53HMTEVVRRYLUNG168p.C176Yc.527G>AMissense_Mutation10.11NCIH1651Y6130N
TP53HNNYMCNSSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE233p.Y234Nc.700T>AMissense_Mutation10.11SUDHL8N000N
TP53HNYMCNSSCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE234p.Y234Hc.700T>CMissense_Mutation10.11RAJIN000N
TP53HPPGTRVRAENDOMETRIUM151p.P151Hc.452C>AMissense_Mutation10.11HEC108Y8100N
TP53HRIRVEGNLSTOMACH193p.L194Rc.581T>GMissense_Mutation10.11GSSY8130N
TP53HRVVVPYEPOVARY214p.S215Rc.643A>CMissense_Mutation10.11OV90N100N
TP53HSLVVPYEPLUNG214p.V216Lc.646G>TMissense_Mutation10.11LCLC103HN000N
TP53HSVGVPYEPBILIARY_TRACT214p.V217Gc.650T>GMissense_Mutation10.11SNU308N000N
TP53HSVVLPYEPLARGE_INTESTINE214p.V218Lc.652G>TMissense_Mutation10.11SNUC5N000N
TP53HYNYKCNSSSOFT_TISSUE233p.M237Kc.710T>AMissense_Mutation10.11SKLMS1N100N
TP53HYNYMCNRSLUNG233p.S240Rc.720T>AMissense_Mutation10.11NCIH2023N200N
TP53HYNYMCNSYENDOMETRIUM233p.S241Yc.722C>AMissense_Mutation10.11HEC251N500N
TP53HYNYMCSSSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE233p.N239Sc.716A>GMissense_Mutation10.11PF382N100N
TP53HYNYMGNSSCENTRAL_NERVOUS_SYSTEM233p.C238Gc.712T>GMissense_Mutation10.11TM31N200N
TP53HYNYMYNSSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE233p.C238Yc.713G>AMissense_Mutation10.11MC116N300N
TP53IFRHSVVVPCENTRAL_NERVOUS_SYSTEM211p.T211Ic.632C>TMissense_Mutation10.1142MGBAN0012N
TP53IHDNYMCNSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE232p.Y234Dc.700T>GMissense_Mutation10.11KASUMI6N200N
TP53IHHNYMCNSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE232p.Y234Hc.700T>CMissense_Mutation10.11RAJIN100N
TP53IHKQSQHMTHAEMATOPOIETIC_AND_LYMPHOID_TISSUE162p.Y163Hc.487T>CMissense_Mutation10.11P3HR1N000N
TP53IHNNYMCNSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE232p.Y234Nc.700T>AMissense_Mutation10.11SUDHL8N100N
TP53IHYNYKCNSSOFT_TISSUE232p.M237Kc.710T>AMissense_Mutation10.11SKLMS1N1032N
TP53IHYNYMCNRLUNG232p.S240Rc.720T>AMissense_Mutation10.11NCIH2023N100N
TP53IHYNYMCSSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE232p.N239Sc.716A>GMissense_Mutation10.11PF382N200N
TP53IHYNYMGNSCENTRAL_NERVOUS_SYSTEM232p.C238Gc.712T>GMissense_Mutation10.11TM31N200N
TP53IHYNYMYNSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE232p.C238Yc.713G>AMissense_Mutation10.11MC116N200N
TP53IITLADSSGSALIVARY_GLAND254p.E258Ac.773A>CMissense_Mutation10.11YD15N000N
TP53IITLEDSSDLIVER254p.G262Dc.785G>AMissense_Mutation10.11SNU475N000N
TP53IITLEDSSVLUNG254p.G262Vc.785G>TMissense_Mutation10.11NCIH2030N300N
TP53IITLEDSTGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE254p.S261Tc.782G>CMissense_Mutation10.11L363N000N
TP53IITLENSSGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE254p.D259Nc.775G>AMissense_Mutation10.11BCP1N006N
TP53IITLEVSSGLUNG254p.D259Vc.776A>TMissense_Mutation10.11HCC15N005N
TP53IITLKDSSGSKIN254p.E258Kc.772G>AMissense_Mutation10.11MEWON000N
TP53ILTIITLADSALIVARY_GLAND251p.E258Ac.773A>CMissense_Mutation10.11YD15N0020N
TP53ILTIITLENHAEMATOPOIETIC_AND_LYMPHOID_TISSUE251p.D259Nc.775G>AMissense_Mutation10.11BCP1N0018N
TP53ILTIITLEVLUNG251p.D259Vc.776A>TMissense_Mutation10.11HCC15Y81126N
TP53ILTIITLKDSKIN251p.E258Kc.772G>AMissense_Mutation10.11MEWON0020N
TP53ILTINTLEDPANCREAS251p.I255Nc.764T>AMissense_Mutation10.11PANC1005N2020N
TP53ILTITTLEDPANCREAS251p.I255Tc.764T>CMissense_Mutation10.11HUPT4N0020N
TP53INTLEDSSGPANCREAS254p.I255Nc.764T>AMissense_Mutation10.11PANC1005N000N
TP53IPTIITLEDLUNG251p.L252Pc.755T>CMissense_Mutation10.11CORL51N203N
TP53IPVEGNLRVLARGE_INTESTINE195p.R196Pc.587G>CMissense_Mutation10.11HCC56N1403N
TP53IRGRECFEMOESOPHAGUS332p.R337Cc.1009C>TMissense_Mutation10.11KYSE410N4023Y
TP53IRRPILTIILUNG247p.N247Ic.740A>TMissense_Mutation10.11HCC1171Y7124N
TP53IRVEGNLRLBONE195p.V203Lc.607G>TMissense_Mutation10.11SW1353Y9915N
TP53IRVRERFEMLUNG332p.G334Vc.1001G>TMissense_Mutation10.11NCIH1184Y6932N
TP53ITLADSSGNSALIVARY_GLAND255p.E258Ac.773A>CMissense_Mutation10.11YD15N002N
TP53ITLEDSSDNLIVER255p.G262Dc.785G>AMissense_Mutation10.11SNU475N100N
TP53ITLEDSSVNLUNG255p.G262Vc.785G>TMissense_Mutation10.11NCIH2030N100N
TP53ITLEDSTGNHAEMATOPOIETIC_AND_LYMPHOID_TISSUE255p.S261Tc.782G>CMissense_Mutation10.11L363N100N
TP53ITLENSSGNHAEMATOPOIETIC_AND_LYMPHOID_TISSUE255p.D259Nc.775G>AMissense_Mutation10.11BCP1N200N
TP53ITLEVSSGNLUNG255p.D259Vc.776A>TMissense_Mutation10.11HCC15N100N
TP53ITLKDSSGNSKIN255p.E258Kc.772G>AMissense_Mutation10.11MEWON101N
TP53ITTLEDSSGPANCREAS254p.I255Tc.764T>CMissense_Mutation10.11HUPT4N000N
TP53IYNQSQHMTLUNG162p.K164Nc.492G>TMissense_Mutation10.11NCIH650N200N
TP53KCNSSCMGGSOFT_TISSUE237p.M237Kc.710T>AMissense_Mutation10.11SKLMS1N000N
TP53KDRRTEEENBREAST280p.R280Kc.839G>AMissense_Mutation10.11MDAMB231N100N
TP53KDSSGNLLGSKIN258p.E258Kc.772G>AMissense_Mutation10.11MEWON100N
TP53KGEPYHELPURINARY_TRACT292p.H296Yc.886C>TMissense_Mutation10.11UBLC1N000N
TP53KKGEPYHELURINARY_TRACT291p.H296Yc.886C>TMissense_Mutation10.11UBLC1Y6110N
TP53KKKPLDGKYOESOPHAGUS319p.E326Kc.976G>AMissense_Mutation10.11KYSE30N300Y
TP53KKPLDGKYFOESOPHAGUS320p.E326Kc.976G>AMissense_Mutation10.11KYSE30N500Y
TP53KLLLENNVLSKIN24p.P27Lc.80C>TMissense_Mutation10.11COLO783N1500N
TP53KMCCQLAKTLUNG132p.F134Cc.401T>GMissense_Mutation10.11CORL51N500N
TP53KMFCQLPKTHAEMATOPOIETIC_AND_LYMPHOID_TISSUE132p.A138Pc.412G>CMissense_Mutation10.11RLN600Y
TP53KMFFQLAKTLUNG132p.C135Fc.404G>TMissense_Mutation10.11CAL12TN600N
TP53KMFRQLAKTSKIN132p.C135Rc.403T>CMissense_Mutation10.11COLO818N600N
TP53KNKPLDGEYURINARY_TRACT319p.K320Nc.960G>CMissense_Mutation10.11J82N700Y
TP53KPLDGKYFTOESOPHAGUS321p.E326Kc.976G>AMissense_Mutation10.11KYSE30N700N
TP53KSVTCTCSPOVARY120p.Y126Cc.377A>GMissense_Mutation10.11IGROV1N000N
TP53KSVTCTYFPPANCREAS120p.S127Fc.380C>TMissense_Mutation10.11SNU410N000N
TP53KSVTCTYPPLARGE_INTESTINE120p.S127Pc.379T>CMissense_Mutation10.11CL34N000N
TP53KTWPVQLWVLUNG139p.C141Wc.423C>GMissense_Mutation10.11NCIH1435Y15120N
TP53KVGSDCTTIBREAST224p.E224Kc.670G>AMissense_Mutation10.11CAL148Y590N
TP53KYFTLQIRGOESOPHAGUS326p.E326Kc.976G>AMissense_Mutation10.11KYSE30N000N
TP53LADSSGNLLSALIVARY_GLAND257p.E258Ac.773A>CMissense_Mutation10.11YD15N1200N
TP53LAKTWPVQLLUNG137p.C141Wc.423C>GMissense_Mutation10.11NCIH1435N1002N
TP53LALPQHLIRLARGE_INTESTINE188p.P190Lc.569C>TMissense_Mutation10.11SNU1033N500N
TP53LAPPQHFIRBREAST188p.L194Fc.580C>TMissense_Mutation10.11T47DN500N
TP53LAPPQHLFROVARY188p.I195Fc.583A>TMissense_Mutation10.11COV318N500N
TP53LAPPQHLIPLARGE_INTESTINE188p.R196Pc.587G>CMissense_Mutation10.11HCC56N000N
TP53LAPPQHLSRENDOMETRIUM188p.I195Sc.584T>GMissense_Mutation10.11SNU1077N500Y
TP53LAPPQHRIRSTOMACH188p.L194Rc.581T>GMissense_Mutation10.11GSSN300N
TP53LAPPQLLIRUPPER_AERODIGESTIVE_TRACT188p.H193Lc.578A>TMissense_Mutation10.11CAL27N500N
TP53LAPPQPLIRSTOMACH188p.H193Pc.578A>CMissense_Mutation10.11HUG1NN500Y
TP53LAPPQYLIRCENTRAL_NERVOUS_SYSTEM188p.H193Yc.577C>TMissense_Mutation10.11KNS60N500N
TP53LCKKGEPHHHAEMATOPOIETIC_AND_LYMPHOID_TISSUE289p.R290Cc.868C>TMissense_Mutation10.11CMLT1N000N
TP53LCPHHERCSLUNG175p.R175Lc.524G>TMissense_Mutation10.11HCC44N008N
TP53LDDRNAFRHHAEMATOPOIETIC_AND_LYMPHOID_TISSUE206p.T211Ac.631A>GMissense_Mutation10.11CI1N000N
TP53LDDRNIFRHCENTRAL_NERVOUS_SYSTEM206p.T211Ic.632C>TMissense_Mutation10.1142MGBAN000N
TP53LDGEYFTLRPROSTATE323p.Q331Rc.992A>GMissense_Mutation10.1122RV1N100N
TP53LDGKYFTLQOESOPHAGUS323p.E326Kc.976G>AMissense_Mutation10.11KYSE30N100Y
TP53LEDSSDNLLLIVER257p.G262Dc.785G>AMissense_Mutation10.11SNU475N900Y
TP53LEDSSGNLPCENTRAL_NERVOUS_SYSTEM257p.L265Pc.794T>CMissense_Mutation10.11GAMGN000Y
TP53LEDSSVNLLLUNG257p.G262Vc.785G>TMissense_Mutation10.11NCIH2030N902N
TP53LEDSTGNLLHAEMATOPOIETIC_AND_LYMPHOID_TISSUE257p.S261Tc.782G>CMissense_Mutation10.11L363N900Y
TP53LENNVLSPLSKIN27p.P27Lc.80C>TMissense_Mutation10.11COLO783N1000N
TP53LENSSGNLLHAEMATOPOIETIC_AND_LYMPHOID_TISSUE257p.D259Nc.775G>AMissense_Mutation10.11BCP1N902N
TP53LETFSDLWKLUNG16p.Q16Lc.47A>TMissense_Mutation10.11NCIH2122N100Y
TP53LEVSSGNLLLUNG257p.D259Vc.776A>TMissense_Mutation10.11HCC15N1102N
TP53LEYLDDRNTBONE203p.V203Lc.607G>TMissense_Mutation10.11SW1353N500N
TP53LFRVEGNLROVARY194p.I195Fc.583A>TMissense_Mutation10.11COV318N202N
TP53LGWNSFEVRSKIN265p.R267Wc.799C>TMissense_Mutation10.11SKMEL3N100N
TP53LILTIITLEURINARY_TRACT250p.P250Lc.749C>TMissense_Mutation10.11HT1376N001N
TP53LIPVEGNLRLARGE_INTESTINE194p.R196Pc.587G>CMissense_Mutation10.11HCC56N402N
TP53LKDSSGNLLSKIN257p.E258Kc.772G>AMissense_Mutation10.11MEWON702N
TP53LLENNVLSPSKIN26p.P27Lc.80C>TMissense_Mutation10.11COLO783N000N
TP53LLGFLHSGTURINARY_TRACT110p.R110Lc.329G>TMissense_Mutation10.11SCABERN301N
TP53LLGWNSFEVSKIN264p.R267Wc.799C>TMissense_Mutation10.11SKMEL3N1006N
TP53LLIRVEGNLUPPER_AERODIGESTIVE_TRACT193p.H193Lc.578A>TMissense_Mutation10.11CAL27N1303Y
TP53LLLENNVLSSKIN25p.P27Lc.80C>TMissense_Mutation10.11COLO783N109N
TP53LLRRNSFEVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE264p.G266Rc.796G>CMissense_Mutation10.11NCO2N7012N
TP53LLTIITLEDSTOMACH251p.I251Lc.751A>CMissense_Mutation10.11MKN74N0020N
TP53LNEMFCQLABREAST130p.K132Ec.394A>GMissense_Mutation10.11CAL851N100N
TP53LNEVLELKDOVARY344p.A347Vc.1040C>TMissense_Mutation10.11RMUGSN000N
TP53LNKMCCQLALUNG130p.F134Cc.401T>GMissense_Mutation10.11CORL51N106N
TP53LNKMFCQLPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE130p.A138Pc.412G>CMissense_Mutation10.11RLN001N
TP53LNKMFFQLALUNG130p.C135Fc.404G>TMissense_Mutation10.11CAL12TN200N
TP53LNKMFRQLASKIN130p.C135Rc.403T>CMissense_Mutation10.11COLO818N307N
TP53LNNMFCQLAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE130p.K132Nc.396G>CMissense_Mutation10.11EJMN209N
TP53LNTMFCQLALARGE_INTESTINE130p.K132Tc.395A>CMissense_Mutation10.11SNU81N206N
TP53LPGRNSFEVCENTRAL_NERVOUS_SYSTEM264p.L265Pc.794T>CMissense_Mutation10.11GAMGN1300N
TP53LPGTRVRAMHAEMATOPOIETIC_AND_LYMPHOID_TISSUE152p.P152Lc.455C>TMissense_Mutation10.11SR786Y13100N
TP53LPKTCPVQLHAEMATOPOIETIC_AND_LYMPHOID_TISSUE137p.A138Pc.412G>CMissense_Mutation10.11RLN1302N
TP53LPQHLIRVELARGE_INTESTINE190p.P190Lc.569C>TMissense_Mutation10.11SNU1033N204N
TP53LPYEPPEVGLARGE_INTESTINE218p.V218Lc.652G>TMissense_Mutation10.11SNUC5N300N
TP53LQIRGRECFOESOPHAGUS330p.R337Cc.1009C>TMissense_Mutation10.11KYSE410N9017N
TP53LQIRVRERFLUNG330p.G334Vc.1001G>TMissense_Mutation10.11NCIH1184Y81117N
TP53LREKGEPHHSOFT_TISSUE289p.K291Ec.871A>GMissense_Mutation10.11TE125TN200N
TP53LRIRGRERFPROSTATE330p.Q331Rc.992A>GMissense_Mutation10.1122RV1Y41028Y
TP53LRKKGEPYHURINARY_TRACT289p.H296Yc.886C>TMissense_Mutation10.11UBLC1N204N
TP53LRLEYLDDRBONE201p.V203Lc.607G>TMissense_Mutation10.11SW1353N301N
TP53LRRNSFEVRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE265p.G266Rc.796G>CMissense_Mutation10.11NCO2N301N
TP53LRVECLDDRSOFT_TISSUE201p.Y205Cc.614A>GMissense_Mutation10.11SJRH30N301N
TP53LSLETFSDLLUNG14p.Q16Lc.47A>TMissense_Mutation10.11NCIH2122Y19100Y
TP53LSQKTYQGSCENTRAL_NERVOUS_SYSTEM98p.P98Lc.293C>TMissense_Mutation10.11LN229N100Y
TP53LSRVEGNLRENDOMETRIUM194p.I195Sc.584T>GMissense_Mutation10.11SNU1077N302N
TP53LSSSVLSQKCENTRAL_NERVOUS_SYSTEM93p.P98Lc.293C>TMissense_Mutation10.11LN229N100N
TP53LTIITLADSSALIVARY_GLAND252p.E258Ac.773A>CMissense_Mutation10.11YD15N0024N
TP53LTIITLENSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE252p.D259Nc.775G>AMissense_Mutation10.11BCP1N0010N
TP53LTIITLEVSLUNG252p.D259Vc.776A>TMissense_Mutation10.11HCC15N0010N
TP53LTIITLKDSSKIN252p.E258Kc.772G>AMissense_Mutation10.11MEWON1017Y
TP53LTINTLEDSPANCREAS252p.I255Nc.764T>AMissense_Mutation10.11PANC1005N005N
TP53LTITTLEDSPANCREAS252p.I255Tc.764T>CMissense_Mutation10.11HUPT4N000N
TP53LVVPYEPPELUNG216p.V216Lc.646G>TMissense_Mutation10.11LCLC103HN000N
TP53LWKLLLENNSKIN22p.P27Lc.80C>TMissense_Mutation10.11COLO783N000N
TP53LWVDSTAPPOVARY145p.P151Ac.451C>GMissense_Mutation10.11SNU119N007N
TP53LWVDSTHPPENDOMETRIUM145p.P151Hc.452C>AMissense_Mutation10.11HEC108N005N
TP53LWVDSTPLPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE145p.P152Lc.455C>TMissense_Mutation10.11SR786N004N
TP53LWVDSTPSPURINARY_TRACT145p.P152Sc.454C>TMissense_Mutation10.11UMUC1N004N
TP53MAGMNRRPILIVER243p.G244Ac.731G>CMissense_Mutation10.11HLFN8012N
TP53MAIHKQSQHHAEMATOPOIETIC_AND_LYMPHOID_TISSUE160p.Y163Hc.487T>CMissense_Mutation10.11P3HR1N004N
TP53MAIYNQSQHLUNG160p.K164Nc.492G>TMissense_Mutation10.11NCIH650N205N
TP53MANYKQSQHURINARY_TRACT160p.I162Nc.485T>AMissense_Mutation10.11647VN002N
TP53MCCQLAKTCLUNG133p.F134Cc.401T>GMissense_Mutation10.11CORL51N000N
TP53MCGMNRRPILUNG243p.G244Cc.730G>TMissense_Mutation10.11NCIH1836N6012N
TP53MCNRSCMGGLUNG237p.S240Rc.720T>AMissense_Mutation10.11NCIH2023N003N
TP53MCNSSCMAGLIVER237p.G244Ac.731G>CMissense_Mutation10.11HLFN000N
TP53MCNSSCMCGLUNG237p.G244Cc.730G>TMissense_Mutation10.11NCIH1836N000N
TP53MCNSSCMDGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE237p.G244Dc.731G>AMissense_Mutation10.11EB2N000N
TP53MCNSSCMGRLUNG237p.G245Rc.733G>CMissense_Mutation10.11NCIH1930N400N
TP53MCNSSCMGVLUNG237p.G245Vc.734G>TMissense_Mutation10.11CPCNN202N
TP53MCNSSFMGGCENTRAL_NERVOUS_SYSTEM237p.C242Fc.725G>TMissense_Mutation10.11DAOYN000N
TP53MCNSSRMGGPANCREAS237p.C242Rc.724T>CMissense_Mutation10.11CFPAC1N003N
TP53MCNSSWMGGLUNG237p.C242Wc.726C>GMissense_Mutation10.11NCIH2073N000N
TP53MCNSYCMGGENDOMETRIUM237p.S241Yc.722C>AMissense_Mutation10.11HEC251N000N
TP53MCSSSCMGGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE237p.N239Sc.716A>GMissense_Mutation10.11PF382N000N
TP53MDGMNRRPIHAEMATOPOIETIC_AND_LYMPHOID_TISSUE243p.G244Dc.731G>AMissense_Mutation10.11EB2N500Y
TP53MFCQLAKTWLUNG133p.C141Wc.423C>GMissense_Mutation10.11NCIH1435N400N
TP53MFCQLPKTCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE133p.A138Pc.412G>CMissense_Mutation10.11RLN103Y
TP53MFFQLAKTCLUNG133p.C135Fc.404G>TMissense_Mutation10.11CAL12TN105N
TP53MFRELNEVLOVARY340p.A347Vc.1040C>TMissense_Mutation10.11RMUGSY893N
TP53MFRQLAKTCSKIN133p.C135Rc.403T>CMissense_Mutation10.11COLO818N105N
TP53MGGMIRRPILUNG243p.N247Ic.740A>TMissense_Mutation10.11HCC1171N9020Y
TP53MGGMNGRPITHYROID243p.R248Gc.742C>GMissense_Mutation10.118505CN907N
TP53MGGMNRRLIURINARY_TRACT243p.P250Lc.749C>TMissense_Mutation10.11HT1376Y10920N
TP53MGGMNRRPLSTOMACH243p.I251Lc.751A>CMissense_Mutation10.11MKN74N12014N
TP53MGGRNRRPIAUTONOMIC_GANGLIA243p.M246Rc.737T>GMissense_Mutation10.11SKNFIY101015Y
TP53MGGVNRRPIENDOMETRIUM243p.M246Vc.736A>GMissense_Mutation10.11ISHIKAWAHERAKLIO02ERN1003Y
TP53MGNSSCMGGCENTRAL_NERVOUS_SYSTEM237p.C238Gc.712T>GMissense_Mutation10.11TM31N001N
TP53MGRMNRRPILUNG243p.G245Rc.733G>CMissense_Mutation10.11NCIH1930N10027N
TP53MGVMNRRPILUNG243p.G245Vc.734G>TMissense_Mutation10.11CPCNN11025N
TP53MIRRPILTILUNG246p.N247Ic.740A>TMissense_Mutation10.11HCC1171Y61030N
TP53MNGRPILTITHYROID246p.R248Gc.742C>GMissense_Mutation10.118505CY41020N
TP53MNRRLILTIURINARY_TRACT246p.P250Lc.749C>TMissense_Mutation10.11HT1376N7029N
TP53MNRRPIPTILUNG246p.L252Pc.755T>CMissense_Mutation10.11CORL51Y4116N
TP53MNRRPLLTISTOMACH246p.I251Lc.751A>CMissense_Mutation10.11MKN74Y6922N
TP53MNRRPNLTILIVER246p.I251Nc.752T>AMissense_Mutation10.11SNU878N6012N
TP53MRRCPHHERHAEMATOPOIETIC_AND_LYMPHOID_TISSUE173p.V173Mc.517G>AMissense_Mutation10.11MOLM16Y3910N
TP53MTEVMRRCPHAEMATOPOIETIC_AND_LYMPHOID_TISSUE169p.V173Mc.517G>AMissense_Mutation10.11MOLM16N000N
TP53MTEVVRLCPLUNG169p.R175Lc.524G>TMissense_Mutation10.11HCC44N100N
TP53MTEVVRRCTAUTONOMIC_GANGLIA169p.P177Tc.529C>AMissense_Mutation10.11KELLYN200N
TP53MTEVVRRSPPANCREAS169p.C176Sc.526T>AMissense_Mutation10.11PATU8902N000N
TP53MTEVVRRYPLUNG169p.C176Yc.527G>AMissense_Mutation10.11NCIH1651N000N
TP53MYNSSCMGGHAEMATOPOIETIC_AND_LYMPHOID_TISSUE237p.C238Yc.713G>AMissense_Mutation10.11MC116N004N
TP53NAFRHSVVVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE210p.T211Ac.631A>GMissense_Mutation10.11CI1N600N
TP53NEMFCQLAKBREAST131p.K132Ec.394A>GMissense_Mutation10.11CAL851N200N
TP53NEVLELKDAOVARY345p.A347Vc.1040C>TMissense_Mutation10.11RMUGSN500Y
TP53NGRPILTIITHYROID247p.R248Gc.742C>GMissense_Mutation10.118505CN900N
TP53NIFRHSVVVCENTRAL_NERVOUS_SYSTEM210p.T211Ic.632C>TMissense_Mutation10.1142MGBAN700N
TP53NKMCCQLAKLUNG131p.F134Cc.401T>GMissense_Mutation10.11CORL51N100N
TP53NKMFCQLPKHAEMATOPOIETIC_AND_LYMPHOID_TISSUE131p.A138Pc.412G>CMissense_Mutation10.11RLN100Y
TP53NKMFFQLAKLUNG131p.C135Fc.404G>TMissense_Mutation10.11CAL12TN100N
TP53NKMFRQLAKSKIN131p.C135Rc.403T>CMissense_Mutation10.11COLO818N100N
TP53NKPLDGEYFURINARY_TRACT320p.K320Nc.960G>CMissense_Mutation10.11J82N300Y
TP53NLCKKGEPHHAEMATOPOIETIC_AND_LYMPHOID_TISSUE288p.R290Cc.868C>TMissense_Mutation10.11CMLT1N000N
TP53NLLGWNSFESKIN263p.R267Wc.799C>TMissense_Mutation10.11SKMEL3N100N
TP53NLLRRNSFEHAEMATOPOIETIC_AND_LYMPHOID_TISSUE263p.G266Rc.796G>CMissense_Mutation10.11NCO2N000N
TP53NLPGRNSFECENTRAL_NERVOUS_SYSTEM263p.L265Pc.794T>CMissense_Mutation10.11GAMGN000N
TP53NLREKGEPHSOFT_TISSUE288p.K291Ec.871A>GMissense_Mutation10.11TE125TN100N
TP53NLRKKGEPYURINARY_TRACT288p.H296Yc.886C>TMissense_Mutation10.11UBLC1N600N
TP53NLRLEYLDDBONE200p.V203Lc.607G>TMissense_Mutation10.11SW1353N000N
TP53NLRVECLDDSOFT_TISSUE200p.Y205Cc.614A>GMissense_Mutation10.11SJRH30N000N
TP53NLTIITLEDLIVER251p.I251Nc.752T>AMissense_Mutation10.11SNU878N000N
TP53NMFCQLAKTHAEMATOPOIETIC_AND_LYMPHOID_TISSUE132p.K132Nc.396G>CMissense_Mutation10.11EJMN600N
TP53NNMFCQLAKHAEMATOPOIETIC_AND_LYMPHOID_TISSUE131p.K132Nc.396G>CMissense_Mutation10.11EJMN100N
TP53NNYMCNSSCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE234p.Y234Nc.700T>AMissense_Mutation10.11SUDHL8N000N
TP53NQSQHMTEVLUNG164p.K164Nc.492G>TMissense_Mutation10.11NCIH650Y7100N
TP53NRRLILTIIURINARY_TRACT247p.P250Lc.749C>TMissense_Mutation10.11HT1376Y590N
TP53NRRPILTINPANCREAS247p.I255Nc.764T>AMissense_Mutation10.11PANC1005N200N
TP53NRRPILTITPANCREAS247p.I255Tc.764T>CMissense_Mutation10.11HUPT4N200N
TP53NRRPIPTIILUNG247p.L252Pc.755T>CMissense_Mutation10.11CORL51Y3110N
TP53NRRPLLTIISTOMACH247p.I251Lc.751A>CMissense_Mutation10.11MKN74Y4100N
TP53NRRPNLTIILIVER247p.I251Nc.752T>AMissense_Mutation10.11SNU878Y490N
TP53NRRTEEENLCENTRAL_NERVOUS_SYSTEM281p.D281Nc.841G>AMissense_Mutation10.11SNU201Y3100N
TP53NRSCMGGMNLUNG239p.S240Rc.720T>AMissense_Mutation10.11NCIH2023N200N
TP53NRVRAMAIYLUNG155p.T155Nc.464C>AMissense_Mutation10.11NCIH524Y490N
TP53NSFEVRVYACENTRAL_NERVOUS_SYSTEM268p.C275Yc.824G>AMissense_Mutation10.11GI1Y590N
TP53NSSCMAGMNLIVER239p.G244Ac.731G>CMissense_Mutation10.11HLFN000N
TP53NSSCMCGMNLUNG239p.G244Cc.730G>TMissense_Mutation10.11NCIH1836N000N
TP53NSSCMDGMNHAEMATOPOIETIC_AND_LYMPHOID_TISSUE239p.G244Dc.731G>AMissense_Mutation10.11EB2N000N
TP53NSSCMGGMILUNG239p.N247Ic.740A>TMissense_Mutation10.11HCC1171N500N
TP53NSSCMGGRNAUTONOMIC_GANGLIA239p.M246Rc.737T>GMissense_Mutation10.11SKNFIN000N
TP53NSSCMGGVNENDOMETRIUM239p.M246Vc.736A>GMissense_Mutation10.11ISHIKAWAHERAKLIO02ERN000N
TP53NSSCMGRMNLUNG239p.G245Rc.733G>CMissense_Mutation10.11NCIH1930N000N
TP53NSSCMGVMNLUNG239p.G245Vc.734G>TMissense_Mutation10.11CPCNN000N
TP53NSSFMGGMNCENTRAL_NERVOUS_SYSTEM239p.C242Fc.725G>TMissense_Mutation10.11DAOYN000N
TP53NSSGNLLGRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE259p.D259Nc.775G>AMissense_Mutation10.11BCP1N500N
TP53NSSRMGGMNPANCREAS239p.C242Rc.724T>CMissense_Mutation10.11CFPAC1N000N
TP53NSSWMGGMNLUNG239p.C242Wc.726C>GMissense_Mutation10.11NCIH2073N000N
TP53NSYCMGGMNENDOMETRIUM239p.S241Yc.722C>AMissense_Mutation10.11HEC251N000N
TP53NTFRHCVVVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE210p.S215Cc.643A>TMissense_Mutation10.11DELN700N
TP53NTFRHRVVVOVARY210p.S215Rc.643A>CMissense_Mutation10.11OV90N800N
TP53NTFRHSLVVLUNG210p.V216Lc.646G>TMissense_Mutation10.11LCLC103HN700N
TP53NTFRHSVGVBILIARY_TRACT210p.V217Gc.650T>GMissense_Mutation10.11SNU308N700N
TP53NTFRHSVVLLARGE_INTESTINE210p.V218Lc.652G>TMissense_Mutation10.11SNUC5N1400N
TP53NTLEDSSGNPANCREAS255p.I255Nc.764T>AMissense_Mutation10.11PANC1005N000N
TP53NTMFCQLAKLARGE_INTESTINE131p.K132Tc.395A>CMissense_Mutation10.11SNU81N500N
TP53NYKCNSSCMSOFT_TISSUE235p.M237Kc.710T>AMissense_Mutation10.11SKLMS1Y5100N
TP53NYKQSQHMTURINARY_TRACT162p.I162Nc.485T>AMissense_Mutation10.11647VN100N
TP53NYMCNRSCMLUNG235p.S240Rc.720T>AMissense_Mutation10.11NCIH2023Y5100N
TP53NYMCNSSFMCENTRAL_NERVOUS_SYSTEM235p.C242Fc.725G>TMissense_Mutation10.11DAOYY5100N
TP53NYMCNSSRMPANCREAS235p.C242Rc.724T>CMissense_Mutation10.11CFPAC1Y5110N
TP53NYMCNSSWMLUNG235p.C242Wc.726C>GMissense_Mutation10.11NCIH2073Y5100N
TP53NYMCNSYCMENDOMETRIUM235p.S241Yc.722C>AMissense_Mutation10.11HEC251Y6100N
TP53NYMCSSSCMHAEMATOPOIETIC_AND_LYMPHOID_TISSUE235p.N239Sc.716A>GMissense_Mutation10.11PF382Y3100N
TP53NYMGNSSCMCENTRAL_NERVOUS_SYSTEM235p.C238Gc.712T>GMissense_Mutation10.11TM31N500N
TP53NYMYNSSCMHAEMATOPOIETIC_AND_LYMPHOID_TISSUE235p.C238Yc.713G>AMissense_Mutation10.11MC116Y5100N
TP53PAFNKMFCQLUNG128p.L130Fc.388C>TMissense_Mutation10.11HCC1359N000N
TP53PALNEMFCQBREAST128p.K132Ec.394A>GMissense_Mutation10.11CAL851N000N
TP53PALNKMCCQLUNG128p.F134Cc.401T>GMissense_Mutation10.11CORL51N000N
TP53PALNKMFFQLUNG128p.C135Fc.404G>TMissense_Mutation10.11CAL12TN000N
TP53PALNKMFRQSKIN128p.C135Rc.403T>CMissense_Mutation10.11COLO818N000N
TP53PALNNMFCQHAEMATOPOIETIC_AND_LYMPHOID_TISSUE128p.K132Nc.396G>CMissense_Mutation10.11EJMN000N
TP53PALNTMFCQLARGE_INTESTINE128p.K132Tc.395A>CMissense_Mutation10.11SNU81N000N
TP53PAMAIYKQSLUNG158p.R158Pc.473G>CMissense_Mutation10.11NCIH2110N000N
TP53PAVNKMFCQOVARY128p.L130Vc.388C>GMissense_Mutation10.11OVCAR4N000N
TP53PGGDRRTEESKIN278p.R280Gc.838A>GMissense_Mutation10.11CJMN000N
TP53PGKDRRTEEBREAST278p.R280Kc.839G>AMissense_Mutation10.11MDAMB231N000N
TP53PGNRVRAMALUNG153p.T155Nc.464C>AMissense_Mutation10.11NCIH524N000N
TP53PGPRVRAMALUNG153p.T155Pc.463A>CMissense_Mutation10.11DMS153N000N
TP53PGRDGRTEELUNG278p.R282Gc.844C>GMissense_Mutation10.11NCIH510N000N
TP53PGRDQRTEECENTRAL_NERVOUS_SYSTEM278p.R282Qc.845G>AMissense_Mutation10.1142MGBAN000N
TP53PGRNRRTEECENTRAL_NERVOUS_SYSTEM278p.D281Nc.841G>AMissense_Mutation10.11SNU201N000N
TP53PGRNSFEVRCENTRAL_NERVOUS_SYSTEM265p.L265Pc.794T>CMissense_Mutation10.11GAMGN000N
TP53PGRYRRTEEOVARY278p.D281Yc.841G>TMissense_Mutation10.11KURAMOCHIN000N
TP53PGSDRRTEESOFT_TISSUE278p.R280Sc.840A>TMissense_Mutation10.11SJRH30N000N
TP53PGTRVPAMALUNG153p.R158Pc.473G>CMissense_Mutation10.11NCIH2110N000N
TP53PGTRVRPMAUPPER_AERODIGESTIVE_TRACT153p.A159Pc.475G>CMissense_Mutation10.11SNU1214N000N
TP53PHDERCSDSOVARY177p.H179Dc.535C>GMissense_Mutation10.11FUOV1N100N
TP53PHHECCSDSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE177p.R181Cc.541C>TMissense_Mutation10.11CMLT1N000N
TP53PILTIITLASALIVARY_GLAND250p.E258Ac.773A>CMissense_Mutation10.11YD15N100N
TP53PILTIITLKSKIN250p.E258Kc.772G>AMissense_Mutation10.11MEWON100N
TP53PILTINTLEPANCREAS250p.I255Nc.764T>AMissense_Mutation10.11PANC1005N000N
TP53PILTITTLEPANCREAS250p.I255Tc.764T>CMissense_Mutation10.11HUPT4N000N
TP53PIPTIITLELUNG250p.L252Pc.755T>CMissense_Mutation10.11CORL51N000N
TP53PKKKPLDGKOESOPHAGUS318p.E326Kc.976G>AMissense_Mutation10.11KYSE30N100Y
TP53PKNKPLDGEURINARY_TRACT318p.K320Nc.960G>CMissense_Mutation10.11J82N000Y
TP53PKTCPVQLWHAEMATOPOIETIC_AND_LYMPHOID_TISSUE138p.A138Pc.412G>CMissense_Mutation10.11RLN000N
TP53PKVGSDCTTBREAST223p.E224Kc.670G>AMissense_Mutation10.11CAL148N000N
TP53PLDGKYFTLOESOPHAGUS322p.E326Kc.976G>AMissense_Mutation10.11KYSE30Y290N
TP53PLIRVEGNLSTOMACH193p.H193Pc.578A>CMissense_Mutation10.11HUG1NN200N
TP53PLLTIITLESTOMACH250p.I251Lc.751A>CMissense_Mutation10.11MKN74N000N
TP53PLPGTRVRAHAEMATOPOIETIC_AND_LYMPHOID_TISSUE151p.P152Lc.455C>TMissense_Mutation10.11SR786N100N
TP53PLSLETFSDLUNG13p.Q16Lc.47A>TMissense_Mutation10.11NCIH2122N000Y
TP53PLSSSVLSQCENTRAL_NERVOUS_SYSTEM92p.P98Lc.293C>TMissense_Mutation10.11LN229N000N
TP53PMAIYKQSQUPPER_AERODIGESTIVE_TRACT159p.A159Pc.475G>CMissense_Mutation10.11SNU1214N000N
TP53PNLTIITLELIVER250p.I251Nc.752T>AMissense_Mutation10.11SNU878N000N
TP53PPALNKMFCLARGE_INTESTINE127p.S127Pc.379T>CMissense_Mutation10.11CL34N000N
TP53PPGNRVRAMLUNG152p.T155Nc.464C>AMissense_Mutation10.11NCIH524Y7100N
TP53PPGPRVRAMLUNG152p.T155Pc.463A>CMissense_Mutation10.11DMS153Y7100N
TP53PPGTRVPAMLUNG152p.R158Pc.473G>CMissense_Mutation10.11NCIH2110N700N
TP53PPGTRVRPMUPPER_AERODIGESTIVE_TRACT152p.A159Pc.475G>CMissense_Mutation10.11SNU1214Y7100N
TP53PPKVGSDCTBREAST222p.E224Kc.670G>AMissense_Mutation10.11CAL148N000N
TP53PPLSLETFSLUNG12p.Q16Lc.47A>TMissense_Mutation10.11NCIH2122N000Y
TP53PPPGNRVRALUNG151p.T155Nc.464C>AMissense_Mutation10.11NCIH524N400N
TP53PPPGPRVRALUNG151p.T155Pc.463A>CMissense_Mutation10.11DMS153N400N
TP53PPPGTRVPALUNG151p.R158Pc.473G>CMissense_Mutation10.11NCIH2110N400N
TP53PPPGTRVRPUPPER_AERODIGESTIVE_TRACT151p.A159Pc.475G>CMissense_Mutation10.11SNU1214N000N
TP53PPQHFIRVEBREAST190p.L194Fc.580C>TMissense_Mutation10.11T47DN000N
TP53PPQHLFRVEOVARY190p.I195Fc.583A>TMissense_Mutation10.11COV318N000N
TP53PPQHLIPVELARGE_INTESTINE190p.R196Pc.587G>CMissense_Mutation10.11HCC56N000N
TP53PPQHLSRVEENDOMETRIUM190p.I195Sc.584T>GMissense_Mutation10.11SNU1077N000N
TP53PPQHRIRVESTOMACH190p.L194Rc.581T>GMissense_Mutation10.11GSSN000N
TP53PPQLLIRVEUPPER_AERODIGESTIVE_TRACT190p.H193Lc.578A>TMissense_Mutation10.11CAL27N000N
TP53PPQPLIRVESTOMACH190p.H193Pc.578A>CMissense_Mutation10.11HUG1NN000N
TP53PPQYLIRVECENTRAL_NERVOUS_SYSTEM190p.H193Yc.577C>TMissense_Mutation10.11KNS60N000N
TP53PQHFIRVEGBREAST191p.L194Fc.580C>TMissense_Mutation10.11T47DN000N
TP53PQHLFRVEGOVARY191p.I195Fc.583A>TMissense_Mutation10.11COV318N000N
TP53PQHLIPVEGLARGE_INTESTINE191p.R196Pc.587G>CMissense_Mutation10.11HCC56N000N
TP53PQHLSRVEGENDOMETRIUM191p.I195Sc.584T>GMissense_Mutation10.11SNU1077N000N
TP53PQHRIRVEGSTOMACH191p.L194Rc.581T>GMissense_Mutation10.11GSSN000N
TP53PQLLIRVEGUPPER_AERODIGESTIVE_TRACT191p.H193Lc.578A>TMissense_Mutation10.11CAL27N000N
TP53PQPKNKPLDURINARY_TRACT316p.K320Nc.960G>CMissense_Mutation10.11J82N100N
TP53PQPLIRVEGSTOMACH191p.H193Pc.578A>CMissense_Mutation10.11HUG1NN000N
TP53PQYLIRVEGCENTRAL_NERVOUS_SYSTEM191p.H193Yc.577C>TMissense_Mutation10.11KNS60N000N
TP53PRVRAMAIYLUNG155p.T155Pc.463A>CMissense_Mutation10.11DMS153N200N
TP53PSPGTRVRAURINARY_TRACT151p.P152Sc.454C>TMissense_Mutation10.11UMUC1N000N
TP53PSVEPPLSLLUNG8p.Q16Lc.47A>TMissense_Mutation10.11NCIH2122N100Y
TP53PTIITLEDSLUNG252p.L252Pc.755T>CMissense_Mutation10.11CORL51N000N
TP53PVEGNLRVELARGE_INTESTINE196p.R196Pc.587G>CMissense_Mutation10.11HCC56N000N
TP53PYEPPKVGSBREAST219p.E224Kc.670G>AMissense_Mutation10.11CAL148N000N
TP53PYHELPPGSURINARY_TRACT295p.H296Yc.886C>TMissense_Mutation10.11UBLC1N000N
TP53QGSYGFLLGURINARY_TRACT104p.R110Lc.329G>TMissense_Mutation10.11SCABERN000N
TP53QHFIRVEGNBREAST192p.L194Fc.580C>TMissense_Mutation10.11T47DN200N
TP53QHLFRVEGNOVARY192p.I195Fc.583A>TMissense_Mutation10.11COV318N200N
TP53QHLIPVEGNLARGE_INTESTINE192p.R196Pc.587G>CMissense_Mutation10.11HCC56N200N
TP53QHLSRVEGNENDOMETRIUM192p.I195Sc.584T>GMissense_Mutation10.11SNU1077N200N
TP53QHMTEVMRRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE167p.V173Mc.517G>AMissense_Mutation10.11MOLM16N200N
TP53QHMTEVVRLLUNG167p.R175Lc.524G>TMissense_Mutation10.11HCC44N400N
TP53QHRIRVEGNSTOMACH192p.L194Rc.581T>GMissense_Mutation10.11GSSN000N
TP53QIRGRECFEOESOPHAGUS331p.R337Cc.1009C>TMissense_Mutation10.11KYSE410N000N
TP53QIRVRERFELUNG331p.G334Vc.1001G>TMissense_Mutation10.11NCIH1184N000N
TP53QLAKTWPVQLUNG136p.C141Wc.423C>GMissense_Mutation10.11NCIH1435N000N
TP53QLLIRVEGNUPPER_AERODIGESTIVE_TRACT192p.H193Lc.578A>TMissense_Mutation10.11CAL27N000Y
TP53QLPKTCPVQHAEMATOPOIETIC_AND_LYMPHOID_TISSUE136p.A138Pc.412G>CMissense_Mutation10.11RLN000N
TP53QLWVDSTAPOVARY144p.P151Ac.451C>GMissense_Mutation10.11SNU119N000N
TP53QLWVDSTHPENDOMETRIUM144p.P151Hc.452C>AMissense_Mutation10.11HEC108N000N
TP53QLWVDSTPLHAEMATOPOIETIC_AND_LYMPHOID_TISSUE144p.P152Lc.455C>TMissense_Mutation10.11SR786N1100N
TP53QLWVDSTPSURINARY_TRACT144p.P152Sc.454C>TMissense_Mutation10.11UMUC1N000N
TP53QPKNKPLDGURINARY_TRACT317p.K320Nc.960G>CMissense_Mutation10.11J82N100Y
TP53QPLIRVEGNSTOMACH192p.H193Pc.578A>CMissense_Mutation10.11HUG1NN400N
TP53QRTEEENLRCENTRAL_NERVOUS_SYSTEM282p.R282Qc.845G>AMissense_Mutation10.1142MGBAN300N
TP53QSQHMTEVMHAEMATOPOIETIC_AND_LYMPHOID_TISSUE165p.V173Mc.517G>AMissense_Mutation10.11MOLM16N500N
TP53QYLIRVEGNCENTRAL_NERVOUS_SYSTEM192p.H193Yc.577C>TMissense_Mutation10.11KNS60N200Y
TP53RAMAIHKQSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE158p.Y163Hc.487T>CMissense_Mutation10.11P3HR1N200N
TP53RAMAIYNQSLUNG158p.K164Nc.492G>TMissense_Mutation10.11NCIH650N300N
TP53RAMANYKQSURINARY_TRACT158p.I162Nc.485T>AMissense_Mutation10.11647VN300N
TP53RCPHDERCSOVARY175p.H179Dc.535C>GMissense_Mutation10.11FUOV1N000N
TP53RCPHHECCSHAEMATOPOIETIC_AND_LYMPHOID_TISSUE175p.R181Cc.541C>TMissense_Mutation10.11CMLT1N000N
TP53RCTHHERCSAUTONOMIC_GANGLIA175p.P177Tc.529C>AMissense_Mutation10.11KELLYN000N
TP53RDGRTEEENLUNG280p.R282Gc.844C>GMissense_Mutation10.11NCIH510N100N
TP53RDQRTEEENCENTRAL_NERVOUS_SYSTEM280p.R282Qc.845G>AMissense_Mutation10.1142MGBAN100N
TP53RECFEMFREOESOPHAGUS335p.R337Cc.1009C>TMissense_Mutation10.11KYSE410N000Y
TP53REKGEPHHESOFT_TISSUE290p.K291Ec.871A>GMissense_Mutation10.11TE125TN000N
TP53RELNEVLELOVARY342p.A347Vc.1040C>TMissense_Mutation10.11RMUGSY13110N
TP53RGRDRRTEELUNG278p.P278Rc.833C>GMissense_Mutation10.11SCLC21HN100N
TP53RGRECFEMFOESOPHAGUS333p.R337Cc.1009C>TMissense_Mutation10.11KYSE410N600Y
TP53RHCVVVPYEHAEMATOPOIETIC_AND_LYMPHOID_TISSUE213p.S215Cc.643A>TMissense_Mutation10.11DELN000N
TP53RHRVVVPYEOVARY213p.S215Rc.643A>CMissense_Mutation10.11OV90N000N
TP53RHSLVVPYELUNG213p.V216Lc.646G>TMissense_Mutation10.11LCLC103HN000N
TP53RHSVGVPYEBILIARY_TRACT213p.V217Gc.650T>GMissense_Mutation10.11SNU308N000N
TP53RHSVVLPYELARGE_INTESTINE213p.V218Lc.652G>TMissense_Mutation10.11SNUC5N000N
TP53RIRGRERFEPROSTATE331p.Q331Rc.992A>GMissense_Mutation10.1122RV1N100Y
TP53RIRVEGNLRSTOMACH194p.L194Rc.581T>GMissense_Mutation10.11GSSN500N
TP53RKKGEPYHEURINARY_TRACT290p.H296Yc.886C>TMissense_Mutation10.11UBLC1N000N
TP53RLCPHHERCLUNG174p.R175Lc.524G>TMissense_Mutation10.11HCC44N100N
TP53RLEYLDDRNBONE202p.V203Lc.607G>TMissense_Mutation10.11SW1353N100N
TP53RLILTIITLURINARY_TRACT249p.P250Lc.749C>TMissense_Mutation10.11HT1376Y2090N
TP53RMGGMNRRPPANCREAS242p.C242Rc.724T>CMissense_Mutation10.11CFPAC1N000N
TP53RMNRRPILTLUNG245p.G245Rc.733G>CMissense_Mutation10.11NCIH1930N200N
TP53RNAFRHSVVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE209p.T211Ac.631A>GMissense_Mutation10.11CI1Y3150N
TP53RNIFRHSVVCENTRAL_NERVOUS_SYSTEM209p.T211Ic.632C>TMissense_Mutation10.1142MGBAN400N
TP53RNRRPILTIAUTONOMIC_GANGLIA246p.M246Rc.737T>GMissense_Mutation10.11SKNFIY5140N
TP53RNRRTEEENCENTRAL_NERVOUS_SYSTEM280p.D281Nc.841G>AMissense_Mutation10.11SNU201N000N
TP53RNSFEVRVYCENTRAL_NERVOUS_SYSTEM267p.C275Yc.824G>AMissense_Mutation10.11GI1N400N
TP53RNTFRHCVVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE209p.S215Cc.643A>TMissense_Mutation10.11DELN300N
TP53RNTFRHRVVOVARY209p.S215Rc.643A>CMissense_Mutation10.11OV90Y3150N
TP53RNTFRHSLVLUNG209p.V216Lc.646G>TMissense_Mutation10.11LCLC103HN200N
TP53RNTFRHSVGBILIARY_TRACT209p.V217Gc.650T>GMissense_Mutation10.11SNU308N000N
TP53RPILTINTLPANCREAS249p.I255Nc.764T>AMissense_Mutation10.11PANC1005Y2390N
TP53RPILTITTLPANCREAS249p.I255Tc.764T>CMissense_Mutation10.11HUPT4Y2290N
TP53RPIPTIITLLUNG249p.L252Pc.755T>CMissense_Mutation10.11CORL51Y2290N
TP53RPLLTIITLSTOMACH249p.I251Lc.751A>CMissense_Mutation10.11MKN74Y2290N
TP53RPMAIYKQSUPPER_AERODIGESTIVE_TRACT158p.A159Pc.475G>CMissense_Mutation10.11SNU1214N400N
TP53RPNLTIITLLIVER249p.I251Nc.752T>AMissense_Mutation10.11SNU878Y1790N
TP53RQLAKTCPVSKIN135p.C135Rc.403T>CMissense_Mutation10.11COLO818N1000N
TP53RRCPHDERCOVARY174p.H179Dc.535C>GMissense_Mutation10.11FUOV1N200N
TP53RRCPHHECCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE174p.R181Cc.541C>TMissense_Mutation10.11CMLT1N200N
TP53RRCTHHERCAUTONOMIC_GANGLIA174p.P177Tc.529C>AMissense_Mutation10.11KELLYN200Y
TP53RRLILTIITURINARY_TRACT248p.P250Lc.749C>TMissense_Mutation10.11HT1376N300N
TP53RRNSFEVRVHAEMATOPOIETIC_AND_LYMPHOID_TISSUE266p.G266Rc.796G>CMissense_Mutation10.11NCO2Y6120N
TP53RRPILTINTPANCREAS248p.I255Nc.764T>AMissense_Mutation10.11PANC1005N300N
TP53RRPILTITTPANCREAS248p.I255Tc.764T>CMissense_Mutation10.11HUPT4N200N
TP53RRPIPTIITLUNG248p.L252Pc.755T>CMissense_Mutation10.11CORL51N200N
TP53RRPLLTIITSTOMACH248p.I251Lc.751A>CMissense_Mutation10.11MKN74N200N
TP53RRPNLTIITLIVER248p.I251Nc.752T>AMissense_Mutation10.11SNU878N200N
TP53RRSPHHERCPANCREAS174p.C176Sc.526T>AMissense_Mutation10.11PATU8902N200N
TP53RRTEEENLCHAEMATOPOIETIC_AND_LYMPHOID_TISSUE282p.R290Cc.868C>TMissense_Mutation10.11CMLT1N200N
TP53RRYPHHERCLUNG174p.C176Yc.527G>AMissense_Mutation10.11NCIH1651N400N
TP53RSCMGGMNRLUNG240p.S240Rc.720T>AMissense_Mutation10.11NCIH2023Y490N
TP53RSPHHERCSPANCREAS175p.C176Sc.526T>AMissense_Mutation10.11PATU8902N100N
TP53RTEEENLCKHAEMATOPOIETIC_AND_LYMPHOID_TISSUE283p.R290Cc.868C>TMissense_Mutation10.11CMLT1N700N
TP53RTEEENLRESOFT_TISSUE283p.K291Ec.871A>GMissense_Mutation10.11TE125TN200N
TP53RVCACHGRDLARGE_INTESTINE273p.P278Hc.833C>AMissense_Mutation10.11CCK81N000N
TP53RVCACPGGDSKIN273p.R280Gc.838A>GMissense_Mutation10.11CJMN000N
TP53RVCACPGKDBREAST273p.R280Kc.839G>AMissense_Mutation10.11MDAMB231N000N
TP53RVCACPGRNCENTRAL_NERVOUS_SYSTEM273p.D281Nc.841G>AMissense_Mutation10.11SNU201N000N
TP53RVCACPGRYOVARY273p.D281Yc.841G>TMissense_Mutation10.11KURAMOCHIN500N
TP53RVCACPGSDSOFT_TISSUE273p.R280Sc.840A>TMissense_Mutation10.11SJRH30N000N
TP53RVCACRGRDLUNG273p.P278Rc.833C>GMissense_Mutation10.11SCLC21HN000N
TP53RVCAFPGRDLUNG273p.C277Fc.830G>TMissense_Mutation10.11SW1271N000N
TP53RVECLDDRNSOFT_TISSUE202p.Y205Cc.614A>GMissense_Mutation10.11SJRH30N100Y
TP53RVEGNLRLEBONE196p.V203Lc.607G>TMissense_Mutation10.11SW1353N000N
TP53RVPAMAIYKLUNG156p.R158Pc.473G>CMissense_Mutation10.11NCIH2110Y5130N
TP53RVRAMAIHKHAEMATOPOIETIC_AND_LYMPHOID_TISSUE156p.Y163Hc.487T>CMissense_Mutation10.11P3HR1Y5140N
TP53RVRAMAIYNLUNG156p.K164Nc.492G>TMissense_Mutation10.11NCIH650N000N
TP53RVRAMANYKURINARY_TRACT156p.I162Nc.485T>AMissense_Mutation10.11647VY5160N
TP53RVRERFEMFLUNG333p.G334Vc.1001G>TMissense_Mutation10.11NCIH1184Y790N
TP53RVRPMAIYKUPPER_AERODIGESTIVE_TRACT156p.A159Pc.475G>CMissense_Mutation10.11SNU1214Y5110N
TP53RVVVPYEPPOVARY215p.S215Rc.643A>CMissense_Mutation10.11OV90N100N
TP53RVYACPGRDCENTRAL_NERVOUS_SYSTEM273p.C275Yc.824G>AMissense_Mutation10.11GI1N000N
TP53RYPHHERCSLUNG175p.C176Yc.527G>AMissense_Mutation10.11NCIH1651N100N
TP53RYRRTEEENOVARY280p.D281Yc.841G>TMissense_Mutation10.11KURAMOCHIN100N
TP53SCMAGMNRRLIVER241p.G244Ac.731G>CMissense_Mutation10.11HLFN400N
TP53SCMCGMNRRLUNG241p.G244Cc.730G>TMissense_Mutation10.11NCIH1836N400N
TP53SCMDGMNRRHAEMATOPOIETIC_AND_LYMPHOID_TISSUE241p.G244Dc.731G>AMissense_Mutation10.11EB2Y490N
TP53SCMGGMIRRLUNG241p.N247Ic.740A>TMissense_Mutation10.11HCC1171Y590N
TP53SCMGGMNGRTHYROID241p.R248Gc.742C>GMissense_Mutation10.118505CN400N
TP53SCMGGRNRRAUTONOMIC_GANGLIA241p.M246Rc.737T>GMissense_Mutation10.11SKNFIY490N
TP53SCMGGVNRRENDOMETRIUM241p.M246Vc.736A>GMissense_Mutation10.11ISHIKAWAHERAKLIO02ERN400Y
TP53SCMGRMNRRLUNG241p.G245Rc.733G>CMissense_Mutation10.11NCIH1930Y490N
TP53SCMGVMNRRLUNG241p.G245Vc.734G>TMissense_Mutation10.11CPCNY490N
TP53SDCTTIHDNHAEMATOPOIETIC_AND_LYMPHOID_TISSUE227p.Y234Dc.700T>GMissense_Mutation10.11KASUMI6N100N
TP53SDCTTIHHNHAEMATOPOIETIC_AND_LYMPHOID_TISSUE227p.Y234Hc.700T>CMissense_Mutation10.11RAJIN100N
TP53SDCTTIHNNHAEMATOPOIETIC_AND_LYMPHOID_TISSUE227p.Y234Nc.700T>AMissense_Mutation10.11SUDHL8N10